FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624073_at:

>probe:Drosophila_2:1624073_at:247:231; Interrogation_Position=160; Antisense; AATGTCCTGCTGAAGATCTTGCTGT
>probe:Drosophila_2:1624073_at:706:95; Interrogation_Position=173; Antisense; AGATCTTGCTGTGGGCTGAGTACCA
>probe:Drosophila_2:1624073_at:512:105; Interrogation_Position=200; Antisense; AGAAACACGAAGAGCCCGCCTGGGT
>probe:Drosophila_2:1624073_at:235:519; Interrogation_Position=223; Antisense; GTGGACAGCAAAGATCCTCTTCCGG
>probe:Drosophila_2:1624073_at:587:275; Interrogation_Position=239; Antisense; CTCTTCCGGCCGAGGAGATTGAGCT
>probe:Drosophila_2:1624073_at:216:419; Interrogation_Position=259; Antisense; GAGCTGCAGATCTCCGATTGGGACA
>probe:Drosophila_2:1624073_at:462:631; Interrogation_Position=290; Antisense; TCCTGCGCGTGGAAATCGATAGCAT
>probe:Drosophila_2:1624073_at:657:161; Interrogation_Position=30; Antisense; AAGGGATGGCCGTACGATAAGCGTA
>probe:Drosophila_2:1624073_at:48:435; Interrogation_Position=328; Antisense; GAGGGCTGCAACTACTTGGACATCC
>probe:Drosophila_2:1624073_at:119:573; Interrogation_Position=356; Antisense; GGCTCTACAAGCTCTGTGCCCAGAA
>probe:Drosophila_2:1624073_at:467:125; Interrogation_Position=404; Antisense; AGCCGGAGACGCAGTTCAGCGGTTA
>probe:Drosophila_2:1624073_at:135:465; Interrogation_Position=446; Antisense; GATTCCAGGATCATTTCATTGAGCA
>probe:Drosophila_2:1624073_at:568:659; Interrogation_Position=47; Antisense; TAAGCGTAAATCTGGCTCTGCTCGA
>probe:Drosophila_2:1624073_at:663:283; Interrogation_Position=64; Antisense; CTGCTCGAGAAATCCTTGGTGATCC

Paste this into a BLAST search page for me
AATGTCCTGCTGAAGATCTTGCTGTAGATCTTGCTGTGGGCTGAGTACCAAGAAACACGAAGAGCCCGCCTGGGTGTGGACAGCAAAGATCCTCTTCCGGCTCTTCCGGCCGAGGAGATTGAGCTGAGCTGCAGATCTCCGATTGGGACATCCTGCGCGTGGAAATCGATAGCATAAGGGATGGCCGTACGATAAGCGTAGAGGGCTGCAACTACTTGGACATCCGGCTCTACAAGCTCTGTGCCCAGAAAGCCGGAGACGCAGTTCAGCGGTTAGATTCCAGGATCATTTCATTGAGCATAAGCGTAAATCTGGCTCTGCTCGACTGCTCGAGAAATCCTTGGTGATCC

Full Affymetrix probeset data:

Annotations for 1624073_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720