FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624074_at:

>probe:Drosophila_2:1624074_at:303:727; Interrogation_Position=112; Antisense; TTGGATCGTCCCTTAATCTGAGCGA
>probe:Drosophila_2:1624074_at:135:115; Interrogation_Position=157; Antisense; AGCAGCATCGTGAGCAGTGCGCCGA
>probe:Drosophila_2:1624074_at:369:47; Interrogation_Position=220; Antisense; ATGCCAAGGACTTCAATAACCCCAC
>probe:Drosophila_2:1624074_at:506:107; Interrogation_Position=247; Antisense; AGAACATCAAGTGCTTTGCCAACTG
>probe:Drosophila_2:1624074_at:518:277; Interrogation_Position=260; Antisense; CTTTGCCAACTGCTTCTTCGAGAAG
>probe:Drosophila_2:1624074_at:583:381; Interrogation_Position=289; Antisense; GAACCCTGAAGGACGGTGAGCTGCA
>probe:Drosophila_2:1624074_at:401:109; Interrogation_Position=331; Antisense; AGAAGCTCGGCGCTCTCATTGGCGA
>probe:Drosophila_2:1624074_at:452:219; Interrogation_Position=381; Antisense; AAGTGCAGGACCATCAAGGGCGAGA
>probe:Drosophila_2:1624074_at:161:107; Interrogation_Position=403; Antisense; AGAACAAGTGTGATACCGCCTCCAA
>probe:Drosophila_2:1624074_at:82:313; Interrogation_Position=420; Antisense; GCCTCCAAGTTGTACGATTGCTTCG
>probe:Drosophila_2:1624074_at:626:463; Interrogation_Position=435; Antisense; GATTGCTTCGAGAGCTTCAAGCCCG
>probe:Drosophila_2:1624074_at:551:187; Interrogation_Position=57; Antisense; AACATGAACTCCTACTTCGTGATCG
>probe:Drosophila_2:1624074_at:221:149; Interrogation_Position=70; Antisense; ACTTCGTGATCGCTTTGAGTGCTCT
>probe:Drosophila_2:1624074_at:551:85; Interrogation_Position=87; Antisense; AGTGCTCTTTTTGTGACTCTGGCTG

Paste this into a BLAST search page for me
TTGGATCGTCCCTTAATCTGAGCGAAGCAGCATCGTGAGCAGTGCGCCGAATGCCAAGGACTTCAATAACCCCACAGAACATCAAGTGCTTTGCCAACTGCTTTGCCAACTGCTTCTTCGAGAAGGAACCCTGAAGGACGGTGAGCTGCAAGAAGCTCGGCGCTCTCATTGGCGAAAGTGCAGGACCATCAAGGGCGAGAAGAACAAGTGTGATACCGCCTCCAAGCCTCCAAGTTGTACGATTGCTTCGGATTGCTTCGAGAGCTTCAAGCCCGAACATGAACTCCTACTTCGTGATCGACTTCGTGATCGCTTTGAGTGCTCTAGTGCTCTTTTTGTGACTCTGGCTG

Full Affymetrix probeset data:

Annotations for 1624074_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720