FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624075_at:

>probe:Drosophila_2:1624075_at:99:539; Interrogation_Position=1127; Antisense; GGTAGGGAACCATTCTAGTCCACTT
>probe:Drosophila_2:1624075_at:506:11; Interrogation_Position=1138; Antisense; ATTCTAGTCCACTTGTACCTCAATA
>probe:Drosophila_2:1624075_at:107:445; Interrogation_Position=1319; Antisense; GATGAACTTGCTTCCATTGCATTGC
>probe:Drosophila_2:1624075_at:339:619; Interrogation_Position=1336; Antisense; TGCATTGCAATGTTCTTAAGACTAA
>probe:Drosophila_2:1624075_at:639:187; Interrogation_Position=1365; Antisense; AACAGCCCGATAATGTGATTGCAAA
>probe:Drosophila_2:1624075_at:384:685; Interrogation_Position=1423; Antisense; TATACACCAGGCCAGACCTCTCAGT
>probe:Drosophila_2:1624075_at:686:579; Interrogation_Position=1447; Antisense; TGGCCTTCGCCTGCTGTACGGAGAG
>probe:Drosophila_2:1624075_at:452:607; Interrogation_Position=1458; Antisense; TGCTGTACGGAGAGCATTCCGTCCT
>probe:Drosophila_2:1624075_at:609:5; Interrogation_Position=1473; Antisense; ATTCCGTCCTCCAGGAGTTCGGTGA
>probe:Drosophila_2:1624075_at:358:467; Interrogation_Position=1489; Antisense; GTTCGGTGACCGGTGGGCCCAACAT
>probe:Drosophila_2:1624075_at:652:37; Interrogation_Position=1512; Antisense; ATCTCCTGGGCTGCTCCAAAGGCGG
>probe:Drosophila_2:1624075_at:115:169; Interrogation_Position=1529; Antisense; AAAGGCGGGCTTGATGTCGTTGTCC
>probe:Drosophila_2:1624075_at:505:525; Interrogation_Position=1535; Antisense; GGGCTTGATGTCGTTGTCCAATATA
>probe:Drosophila_2:1624075_at:195:677; Interrogation_Position=1624; Antisense; TAGTGTCTTTGGTGATTGGCATAAC

Paste this into a BLAST search page for me
GGTAGGGAACCATTCTAGTCCACTTATTCTAGTCCACTTGTACCTCAATAGATGAACTTGCTTCCATTGCATTGCTGCATTGCAATGTTCTTAAGACTAAAACAGCCCGATAATGTGATTGCAAATATACACCAGGCCAGACCTCTCAGTTGGCCTTCGCCTGCTGTACGGAGAGTGCTGTACGGAGAGCATTCCGTCCTATTCCGTCCTCCAGGAGTTCGGTGAGTTCGGTGACCGGTGGGCCCAACATATCTCCTGGGCTGCTCCAAAGGCGGAAAGGCGGGCTTGATGTCGTTGTCCGGGCTTGATGTCGTTGTCCAATATATAGTGTCTTTGGTGATTGGCATAAC

Full Affymetrix probeset data:

Annotations for 1624075_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720