FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624076_at:

>probe:Drosophila_2:1624076_at:524:511; Interrogation_Position=2471; Antisense; GTGAAAACTCCACCCATATGGTCCT
>probe:Drosophila_2:1624076_at:615:23; Interrogation_Position=2486; Antisense; ATATGGTCCTTTCCGAATTCGAAGA
>probe:Drosophila_2:1624076_at:315:375; Interrogation_Position=2506; Antisense; GAAGATTTGATGTATCTCCTCTACA
>probe:Drosophila_2:1624076_at:187:23; Interrogation_Position=2530; Antisense; ATATACAAGTCGAATCTGGCCTCTC
>probe:Drosophila_2:1624076_at:716:495; Interrogation_Position=2560; Antisense; GTCATCTGGCAGTATATCGAGCGCA
>probe:Drosophila_2:1624076_at:160:325; Interrogation_Position=2580; Antisense; GCGCAACTACAAGGTGCTCTGTCGA
>probe:Drosophila_2:1624076_at:29:331; Interrogation_Position=2595; Antisense; GCTCTGTCGAGCACCAAACTTTTTA
>probe:Drosophila_2:1624076_at:620:543; Interrogation_Position=2641; Antisense; GGATTTGTGCCCAGACATCAGAGAT
>probe:Drosophila_2:1624076_at:252:33; Interrogation_Position=2664; Antisense; ATCACATTTTGAGAGGCTACGCCAG
>probe:Drosophila_2:1624076_at:63:381; Interrogation_Position=2727; Antisense; GAACCAAACGCTGATCGAGGTCGAT
>probe:Drosophila_2:1624076_at:627:637; Interrogation_Position=2747; Antisense; TCGATTCTCCGCTGGTGGGCAAAAA
>probe:Drosophila_2:1624076_at:48:69; Interrogation_Position=2823; Antisense; ATGGCTGCTCAATGAGCTTCCTCAG
>probe:Drosophila_2:1624076_at:125:113; Interrogation_Position=2854; Antisense; AGCAGAAGTGATGCCCTTTTGTCCG
>probe:Drosophila_2:1624076_at:176:251; Interrogation_Position=2895; Antisense; CAATGGGTCAAGTCGTCCTCAAGGA

Paste this into a BLAST search page for me
GTGAAAACTCCACCCATATGGTCCTATATGGTCCTTTCCGAATTCGAAGAGAAGATTTGATGTATCTCCTCTACAATATACAAGTCGAATCTGGCCTCTCGTCATCTGGCAGTATATCGAGCGCAGCGCAACTACAAGGTGCTCTGTCGAGCTCTGTCGAGCACCAAACTTTTTAGGATTTGTGCCCAGACATCAGAGATATCACATTTTGAGAGGCTACGCCAGGAACCAAACGCTGATCGAGGTCGATTCGATTCTCCGCTGGTGGGCAAAAAATGGCTGCTCAATGAGCTTCCTCAGAGCAGAAGTGATGCCCTTTTGTCCGCAATGGGTCAAGTCGTCCTCAAGGA

Full Affymetrix probeset data:

Annotations for 1624076_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720