FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624077_at:

>probe:Drosophila_2:1624077_at:541:687; Interrogation_Position=1025; Antisense; TTTGAGGAACTGCAACGTCGCCTGC
>probe:Drosophila_2:1624077_at:106:185; Interrogation_Position=1050; Antisense; AAAATCCCGTGCTCGGCATTAGTGC
>probe:Drosophila_2:1624077_at:8:679; Interrogation_Position=1117; Antisense; TAGAGGATACGACCGCCACAAGGAC
>probe:Drosophila_2:1624077_at:456:677; Interrogation_Position=1160; Antisense; TAGAGGCCTCTGTTTATGTTATGTT
>probe:Drosophila_2:1624077_at:12:467; Interrogation_Position=646; Antisense; GATTGGTTACCCCAATGCTGGCAAA
>probe:Drosophila_2:1624077_at:363:669; Interrogation_Position=678; Antisense; TACTGAATGCACTGACACGGGCCAA
>probe:Drosophila_2:1624077_at:33:523; Interrogation_Position=696; Antisense; GGGCCAAGCCAAAGGTTGCTCCCTA
>probe:Drosophila_2:1624077_at:550:89; Interrogation_Position=759; Antisense; AGTACGATGATCATGTCCAGCTCAC
>probe:Drosophila_2:1624077_at:130:223; Interrogation_Position=827; Antisense; AAGGGCTTGGGCATACAGTTCCTAA
>probe:Drosophila_2:1624077_at:149:93; Interrogation_Position=843; Antisense; AGTTCCTAAAGCACGCCGAGCGTTG
>probe:Drosophila_2:1624077_at:670:129; Interrogation_Position=869; Antisense; ACCTTGTTGCTGTTCGTGTTAGATG
>probe:Drosophila_2:1624077_at:141:475; Interrogation_Position=886; Antisense; GTTAGATGCCAGTGCACCGGAGCCA
>probe:Drosophila_2:1624077_at:243:315; Interrogation_Position=907; Antisense; GCCATGGACGCACTATGAGCAGCTA
>probe:Drosophila_2:1624077_at:190:657; Interrogation_Position=930; Antisense; TAATGCACGAACTCCGCCAGTTTGG

Paste this into a BLAST search page for me
TTTGAGGAACTGCAACGTCGCCTGCAAAATCCCGTGCTCGGCATTAGTGCTAGAGGATACGACCGCCACAAGGACTAGAGGCCTCTGTTTATGTTATGTTGATTGGTTACCCCAATGCTGGCAAATACTGAATGCACTGACACGGGCCAAGGGCCAAGCCAAAGGTTGCTCCCTAAGTACGATGATCATGTCCAGCTCACAAGGGCTTGGGCATACAGTTCCTAAAGTTCCTAAAGCACGCCGAGCGTTGACCTTGTTGCTGTTCGTGTTAGATGGTTAGATGCCAGTGCACCGGAGCCAGCCATGGACGCACTATGAGCAGCTATAATGCACGAACTCCGCCAGTTTGG

Full Affymetrix probeset data:

Annotations for 1624077_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720