Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624079_a_at:

>probe:Drosophila_2:1624079_a_at:572:17; Interrogation_Position=1011; Antisense; ATTTCATTCGATTTTCTTGCCCTTC
>probe:Drosophila_2:1624079_a_at:244:415; Interrogation_Position=1038; Antisense; GAGCGCCCAGTAATAAACAATCTTG
>probe:Drosophila_2:1624079_a_at:75:495; Interrogation_Position=476; Antisense; GTCAAATCCTGGGTGCGGGAGCTCC
>probe:Drosophila_2:1624079_a_at:726:49; Interrogation_Position=506; Antisense; ATGCGCGGCACGGAGATTGCCTTAA
>probe:Drosophila_2:1624079_a_at:175:115; Interrogation_Position=568; Antisense; AGCAGTAACGCACGATGAGGCCCTT
>probe:Drosophila_2:1624079_a_at:577:443; Interrogation_Position=581; Antisense; GATGAGGCCCTTCAATATGCGCGCA
>probe:Drosophila_2:1624079_a_at:703:351; Interrogation_Position=603; Antisense; GCACGGTTGGCGCTCAATATGTAGA
>probe:Drosophila_2:1624079_a_at:542:349; Interrogation_Position=694; Antisense; GCAGTTGAGCCAACGGCAACCGGAT
>probe:Drosophila_2:1624079_a_at:704:717; Interrogation_Position=729; Antisense; TTCGCCTCCAGAATCCGGATACGGA
>probe:Drosophila_2:1624079_a_at:383:659; Interrogation_Position=754; Antisense; TAACCTTAACAACTCCGATGACTCG
>probe:Drosophila_2:1624079_a_at:180:119; Interrogation_Position=810; Antisense; AGCGGTCCTGTTGCGGCATTTAGCC
>probe:Drosophila_2:1624079_a_at:483:345; Interrogation_Position=825; Antisense; GCATTTAGCCGTTCCCATTGTGATA
>probe:Drosophila_2:1624079_a_at:532:411; Interrogation_Position=873; Antisense; GACCTTTAACCGATGTTGATCTTGT
>probe:Drosophila_2:1624079_a_at:70:673; Interrogation_Position=932; Antisense; TACGCGTATTTTTATTATTCCCTAT

Paste this into a BLAST search page for me
ATTTCATTCGATTTTCTTGCCCTTCGAGCGCCCAGTAATAAACAATCTTGGTCAAATCCTGGGTGCGGGAGCTCCATGCGCGGCACGGAGATTGCCTTAAAGCAGTAACGCACGATGAGGCCCTTGATGAGGCCCTTCAATATGCGCGCAGCACGGTTGGCGCTCAATATGTAGAGCAGTTGAGCCAACGGCAACCGGATTTCGCCTCCAGAATCCGGATACGGATAACCTTAACAACTCCGATGACTCGAGCGGTCCTGTTGCGGCATTTAGCCGCATTTAGCCGTTCCCATTGTGATAGACCTTTAACCGATGTTGATCTTGTTACGCGTATTTTTATTATTCCCTAT

Full Affymetrix probeset data:

Annotations for 1624079_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime