FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624082_at:

>probe:Drosophila_2:1624082_at:552:463; Interrogation_Position=1010; Antisense; GATTCGATTTGCTCATCTTTACACA
>probe:Drosophila_2:1624082_at:254:365; Interrogation_Position=1089; Antisense; GAATTTGAATGCCTTTTTCGCCACC
>probe:Drosophila_2:1624082_at:264:215; Interrogation_Position=1117; Antisense; AAGATGGCCTATTCCCTTTTTGCAG
>probe:Drosophila_2:1624082_at:334:229; Interrogation_Position=654; Antisense; AATGGGTCAACTGGGATACTTCGAT
>probe:Drosophila_2:1624082_at:640:533; Interrogation_Position=687; Antisense; GGTGGTGAATCATCAGCGTTTGCTG
>probe:Drosophila_2:1624082_at:644:727; Interrogation_Position=736; Antisense; TTGGTGCGATTCCACAACCTGGTGA
>probe:Drosophila_2:1624082_at:33:417; Interrogation_Position=759; Antisense; GAGCCGGACCATCAGCGAAGTGCAA
>probe:Drosophila_2:1624082_at:710:63; Interrogation_Position=801; Antisense; ATGTGGAGCCACTCTGTGCATCATT
>probe:Drosophila_2:1624082_at:543:667; Interrogation_Position=832; Antisense; TACATGCTCTTCTTTGTGGGCGACA
>probe:Drosophila_2:1624082_at:251:537; Interrogation_Position=867; Antisense; GGTCTACTACTTGGTGTTCTTTGGA
>probe:Drosophila_2:1624082_at:597:713; Interrogation_Position=883; Antisense; TTCTTTGGAGTGGTCTGCGTGCAGC
>probe:Drosophila_2:1624082_at:246:17; Interrogation_Position=923; Antisense; ATTTTGCCAGCGAAGTAGCCGAGGA
>probe:Drosophila_2:1624082_at:465:585; Interrogation_Position=950; Antisense; TGGAACGGCTGCCATATGCGATCTT
>probe:Drosophila_2:1624082_at:515:51; Interrogation_Position=965; Antisense; ATGCGATCTTCTCCAGCAGATGGTA

Paste this into a BLAST search page for me
GATTCGATTTGCTCATCTTTACACAGAATTTGAATGCCTTTTTCGCCACCAAGATGGCCTATTCCCTTTTTGCAGAATGGGTCAACTGGGATACTTCGATGGTGGTGAATCATCAGCGTTTGCTGTTGGTGCGATTCCACAACCTGGTGAGAGCCGGACCATCAGCGAAGTGCAAATGTGGAGCCACTCTGTGCATCATTTACATGCTCTTCTTTGTGGGCGACAGGTCTACTACTTGGTGTTCTTTGGATTCTTTGGAGTGGTCTGCGTGCAGCATTTTGCCAGCGAAGTAGCCGAGGATGGAACGGCTGCCATATGCGATCTTATGCGATCTTCTCCAGCAGATGGTA

Full Affymetrix probeset data:

Annotations for 1624082_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720