FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624085_at:

>probe:Drosophila_2:1624085_at:683:127; Interrogation_Position=1080; Antisense; ACCAACTATTGTGTGGCCGCCAATT
>probe:Drosophila_2:1624085_at:568:375; Interrogation_Position=1109; Antisense; GAAGAACGCCTATCCGCCGCTGTGA
>probe:Drosophila_2:1624085_at:327:69; Interrogation_Position=1133; Antisense; ATGGCGCGGCTAGCTTTAATGGGCC
>probe:Drosophila_2:1624085_at:538:653; Interrogation_Position=1149; Antisense; TAATGGGCCCCATGAGGTTACTTCA
>probe:Drosophila_2:1624085_at:629:195; Interrogation_Position=1216; Antisense; AACGTATTAGGACCGGCATATTCGC
>probe:Drosophila_2:1624085_at:129:345; Interrogation_Position=1231; Antisense; GCATATTCGCCTACCTGACTAATAT
>probe:Drosophila_2:1624085_at:600:17; Interrogation_Position=1254; Antisense; ATTTATACTTATACGATGCCGACAC
>probe:Drosophila_2:1624085_at:275:673; Interrogation_Position=1336; Antisense; TACCGATACAGATGTGACGCACTGA
>probe:Drosophila_2:1624085_at:553:499; Interrogation_Position=792; Antisense; GTCTGGTTTCAGAATCGGCGTGCGA
>probe:Drosophila_2:1624085_at:601:517; Interrogation_Position=840; Antisense; GTGGGCTCCAGGACACTTCTGGATA
>probe:Drosophila_2:1624085_at:603:641; Interrogation_Position=857; Antisense; TCTGGATACGGCTCCTCAGTTGGTG
>probe:Drosophila_2:1624085_at:21:577; Interrogation_Position=884; Antisense; GGCGCCGATTAGCAATAATATGCAC
>probe:Drosophila_2:1624085_at:701:163; Interrogation_Position=909; Antisense; AAATATGCCAATATGCCACACCCAC
>probe:Drosophila_2:1624085_at:267:419; Interrogation_Position=987; Antisense; GAGCTGCGCTCGTGCCAGAACTATA

Paste this into a BLAST search page for me
ACCAACTATTGTGTGGCCGCCAATTGAAGAACGCCTATCCGCCGCTGTGAATGGCGCGGCTAGCTTTAATGGGCCTAATGGGCCCCATGAGGTTACTTCAAACGTATTAGGACCGGCATATTCGCGCATATTCGCCTACCTGACTAATATATTTATACTTATACGATGCCGACACTACCGATACAGATGTGACGCACTGAGTCTGGTTTCAGAATCGGCGTGCGAGTGGGCTCCAGGACACTTCTGGATATCTGGATACGGCTCCTCAGTTGGTGGGCGCCGATTAGCAATAATATGCACAAATATGCCAATATGCCACACCCACGAGCTGCGCTCGTGCCAGAACTATA

Full Affymetrix probeset data:

Annotations for 1624085_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720