FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624086_at:

>probe:Drosophila_2:1624086_at:598:515; Interrogation_Position=1052; Antisense; GTGTAAGCTGCGCAAATCATGCATT
>probe:Drosophila_2:1624086_at:656:497; Interrogation_Position=500; Antisense; GTCTAGCCCGTGGTGGTCAGCAGCT
>probe:Drosophila_2:1624086_at:161:175; Interrogation_Position=548; Antisense; AAAGCGCCGTTAAACTGCTCGTGGA
>probe:Drosophila_2:1624086_at:691:511; Interrogation_Position=613; Antisense; GTGATCAAGATCACCAACCGTCGTG
>probe:Drosophila_2:1624086_at:313:201; Interrogation_Position=628; Antisense; AACCGTCGTGTGAACGCCATTGAGC
>probe:Drosophila_2:1624086_at:106:367; Interrogation_Position=668; Antisense; GAATCGATAGGACTTTGGCCTACAT
>probe:Drosophila_2:1624086_at:182:581; Interrogation_Position=683; Antisense; TGGCCTACATCATCTCGGAGCTGGA
>probe:Drosophila_2:1624086_at:40:137; Interrogation_Position=707; Antisense; ACGAGCTCGAGCGTGAGGAGTTCTA
>probe:Drosophila_2:1624086_at:619:377; Interrogation_Position=756; Antisense; GAAGCGCGAGGCACGCATCAAGGCC
>probe:Drosophila_2:1624086_at:596:43; Interrogation_Position=814; Antisense; ATCGATGTGCGCCAGCAGGCCAATA
>probe:Drosophila_2:1624086_at:609:293; Interrogation_Position=852; Antisense; CGATGACGACGTGCTGTTCTAAGTA
>probe:Drosophila_2:1624086_at:178:149; Interrogation_Position=916; Antisense; ACTATTTTCTGTTCTGTATCCGTTT
>probe:Drosophila_2:1624086_at:137:485; Interrogation_Position=931; Antisense; GTATCCGTTTCCATATTGTAATTCG
>probe:Drosophila_2:1624086_at:270:493; Interrogation_Position=948; Antisense; GTAATTCGCAAAGGGCAAGCCACAA

Paste this into a BLAST search page for me
GTGTAAGCTGCGCAAATCATGCATTGTCTAGCCCGTGGTGGTCAGCAGCTAAAGCGCCGTTAAACTGCTCGTGGAGTGATCAAGATCACCAACCGTCGTGAACCGTCGTGTGAACGCCATTGAGCGAATCGATAGGACTTTGGCCTACATTGGCCTACATCATCTCGGAGCTGGAACGAGCTCGAGCGTGAGGAGTTCTAGAAGCGCGAGGCACGCATCAAGGCCATCGATGTGCGCCAGCAGGCCAATACGATGACGACGTGCTGTTCTAAGTAACTATTTTCTGTTCTGTATCCGTTTGTATCCGTTTCCATATTGTAATTCGGTAATTCGCAAAGGGCAAGCCACAA

Full Affymetrix probeset data:

Annotations for 1624086_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720