FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624088_at:

>probe:Drosophila_2:1624088_at:51:715; Interrogation_Position=2990; Antisense; TTCTACATCTCCAAGTTCATCAGCG
>probe:Drosophila_2:1624088_at:110:471; Interrogation_Position=3049; Antisense; GTTCCACAGCTATGGCCAGTACATT
>probe:Drosophila_2:1624088_at:356:581; Interrogation_Position=3061; Antisense; TGGCCAGTACATTCTGTATCCTTGG
>probe:Drosophila_2:1624088_at:124:75; Interrogation_Position=3108; Antisense; AGGACCGTGCCGATCTCGATCGTGT
>probe:Drosophila_2:1624088_at:427:41; Interrogation_Position=3126; Antisense; ATCGTGTGGCACGACAGGCCGGAAC
>probe:Drosophila_2:1624088_at:233:69; Interrogation_Position=3141; Antisense; AGGCCGGAACGAGCATCACCAAGTC
>probe:Drosophila_2:1624088_at:704:345; Interrogation_Position=3153; Antisense; GCATCACCAAGTCGACGGGCGTGAA
>probe:Drosophila_2:1624088_at:664:373; Interrogation_Position=3175; Antisense; GAAGTATACGGTGGGATCCTCCGCC
>probe:Drosophila_2:1624088_at:366:721; Interrogation_Position=3276; Antisense; TTGAAATGGGCGACACCGGACGGTA
>probe:Drosophila_2:1624088_at:266:293; Interrogation_Position=3320; Antisense; CGATTCATCCAGTACAACGGCAAGG
>probe:Drosophila_2:1624088_at:273:441; Interrogation_Position=3344; Antisense; GATGGTGTGACATTCGCCGATACCG
>probe:Drosophila_2:1624088_at:282:273; Interrogation_Position=3379; Antisense; CATTGCCCAGGGACGCGGAAAATCG
>probe:Drosophila_2:1624088_at:185:549; Interrogation_Position=3429; Antisense; GGAGGCGTGGCCACTAGTCCTGACA
>probe:Drosophila_2:1624088_at:548:87; Interrogation_Position=3444; Antisense; AGTCCTGACACTTAGCTCAATGCGA

Paste this into a BLAST search page for me
TTCTACATCTCCAAGTTCATCAGCGGTTCCACAGCTATGGCCAGTACATTTGGCCAGTACATTCTGTATCCTTGGAGGACCGTGCCGATCTCGATCGTGTATCGTGTGGCACGACAGGCCGGAACAGGCCGGAACGAGCATCACCAAGTCGCATCACCAAGTCGACGGGCGTGAAGAAGTATACGGTGGGATCCTCCGCCTTGAAATGGGCGACACCGGACGGTACGATTCATCCAGTACAACGGCAAGGGATGGTGTGACATTCGCCGATACCGCATTGCCCAGGGACGCGGAAAATCGGGAGGCGTGGCCACTAGTCCTGACAAGTCCTGACACTTAGCTCAATGCGA

Full Affymetrix probeset data:

Annotations for 1624088_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720