FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624090_at:

>probe:Drosophila_2:1624090_at:718:129; Interrogation_Position=139; Antisense; ACCTCCGTGCATTACTACAACGTGC
>probe:Drosophila_2:1624090_at:575:475; Interrogation_Position=389; Antisense; GTTTGCACAACACCCAAGAGCGACA
>probe:Drosophila_2:1624090_at:66:299; Interrogation_Position=415; Antisense; CGCTGGGCCAATTGTCGACGGAAAT
>probe:Drosophila_2:1624090_at:61:387; Interrogation_Position=443; Antisense; GAACAGCCCGATATAGACAATCCAG
>probe:Drosophila_2:1624090_at:377:105; Interrogation_Position=457; Antisense; AGACAATCCAGTTGCTATTGCCCAG
>probe:Drosophila_2:1624090_at:630:619; Interrogation_Position=469; Antisense; TGCTATTGCCCAGGTGCTGATCTCG
>probe:Drosophila_2:1624090_at:565:517; Interrogation_Position=507; Antisense; GTGGCCAGGAGGACGGAACCTTCCT
>probe:Drosophila_2:1624090_at:474:143; Interrogation_Position=546; Antisense; ACTGTCGCCGCTACTACGTGTGCAA
>probe:Drosophila_2:1624090_at:5:141; Interrogation_Position=561; Antisense; ACGTGTGCAACCGTCAGAGGTCGAA
>probe:Drosophila_2:1624090_at:231:645; Interrogation_Position=574; Antisense; TCAGAGGTCGAAGCGCCAGAACTGC
>probe:Drosophila_2:1624090_at:255:197; Interrogation_Position=602; Antisense; AACGGCTACTGGTTCGATCGCGAGC
>probe:Drosophila_2:1624090_at:175:451; Interrogation_Position=617; Antisense; GATCGCGAGCTGAAGGCCTGCCGAC
>probe:Drosophila_2:1624090_at:464:407; Interrogation_Position=639; Antisense; GACTGGCCAGTACCGTCAACAACTG
>probe:Drosophila_2:1624090_at:112:653; Interrogation_Position=654; Antisense; TCAACAACTGTGACGCCAGGCGCAA

Paste this into a BLAST search page for me
ACCTCCGTGCATTACTACAACGTGCGTTTGCACAACACCCAAGAGCGACACGCTGGGCCAATTGTCGACGGAAATGAACAGCCCGATATAGACAATCCAGAGACAATCCAGTTGCTATTGCCCAGTGCTATTGCCCAGGTGCTGATCTCGGTGGCCAGGAGGACGGAACCTTCCTACTGTCGCCGCTACTACGTGTGCAAACGTGTGCAACCGTCAGAGGTCGAATCAGAGGTCGAAGCGCCAGAACTGCAACGGCTACTGGTTCGATCGCGAGCGATCGCGAGCTGAAGGCCTGCCGACGACTGGCCAGTACCGTCAACAACTGTCAACAACTGTGACGCCAGGCGCAA

Full Affymetrix probeset data:

Annotations for 1624090_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720