Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624100_at:

>probe:Drosophila_2:1624100_at:676:373; Interrogation_Position=2668; Antisense; GAAGTATGGACCTGCGATCTGCCGC
>probe:Drosophila_2:1624100_at:557:451; Interrogation_Position=2683; Antisense; GATCTGCCGCGGTAAAGACAAGGTT
>probe:Drosophila_2:1624100_at:385:395; Interrogation_Position=2699; Antisense; GACAAGGTTATTGCCACCATTATTT
>probe:Drosophila_2:1624100_at:362:687; Interrogation_Position=2760; Antisense; TATTATAGGGTTGCGACATCTGGCG
>probe:Drosophila_2:1624100_at:431:401; Interrogation_Position=2774; Antisense; GACATCTGGCGGGTTTTCTGAAATT
>probe:Drosophila_2:1624100_at:591:349; Interrogation_Position=2846; Antisense; GCAGGGATAACAGGGTTCCTCTTAA
>probe:Drosophila_2:1624100_at:346:605; Interrogation_Position=2980; Antisense; TGATGAATTTTCGTGCAATGGCAAA
>probe:Drosophila_2:1624100_at:521:523; Interrogation_Position=3038; Antisense; GGGCGCTAATCTGATGACGCGTAGT
>probe:Drosophila_2:1624100_at:545:411; Interrogation_Position=3053; Antisense; GACGCGTAGTGTATATCCAATGAAC
>probe:Drosophila_2:1624100_at:416:683; Interrogation_Position=3078; Antisense; TATCATGCAAATGTGGCTAGGACGC
>probe:Drosophila_2:1624100_at:177:259; Interrogation_Position=3133; Antisense; CACGACATTTTATCCTTGCTACTAC
>probe:Drosophila_2:1624100_at:140:23; Interrogation_Position=3176; Antisense; ATATGTTCGCTTACTTCGTATTTTA
>probe:Drosophila_2:1624100_at:242:29; Interrogation_Position=3200; Antisense; ATACGTTTTATATGCTCGCTTACTC
>probe:Drosophila_2:1624100_at:119:51; Interrogation_Position=3211; Antisense; ATGCTCGCTTACTCCATATTTTAAG

Paste this into a BLAST search page for me
GAAGTATGGACCTGCGATCTGCCGCGATCTGCCGCGGTAAAGACAAGGTTGACAAGGTTATTGCCACCATTATTTTATTATAGGGTTGCGACATCTGGCGGACATCTGGCGGGTTTTCTGAAATTGCAGGGATAACAGGGTTCCTCTTAATGATGAATTTTCGTGCAATGGCAAAGGGCGCTAATCTGATGACGCGTAGTGACGCGTAGTGTATATCCAATGAACTATCATGCAAATGTGGCTAGGACGCCACGACATTTTATCCTTGCTACTACATATGTTCGCTTACTTCGTATTTTAATACGTTTTATATGCTCGCTTACTCATGCTCGCTTACTCCATATTTTAAG

Full Affymetrix probeset data:

Annotations for 1624100_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime