FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624101_at:

>probe:Drosophila_2:1624101_at:724:605; Interrogation_Position=1233; Antisense; TGATCCCAGCTCTTGGTATTCACTA
>probe:Drosophila_2:1624101_at:81:395; Interrogation_Position=1265; Antisense; GAAATCTATCCCGAACCGGAGAAGT
>probe:Drosophila_2:1624101_at:310:329; Interrogation_Position=1288; Antisense; GTTCAAGCCGGAGCGATTTACGGAT
>probe:Drosophila_2:1624101_at:607:17; Interrogation_Position=1303; Antisense; ATTTACGGATGAGGCGATCGCCGCG
>probe:Drosophila_2:1624101_at:521:285; Interrogation_Position=1342; Antisense; CTGGCTGCCGTTTGGAGAAGGTCCC
>probe:Drosophila_2:1624101_at:647:41; Interrogation_Position=1376; Antisense; ATCGGTCTTCGGTTTGGACTGATGC
>probe:Drosophila_2:1624101_at:65:467; Interrogation_Position=1413; Antisense; GATTGGCCTATCTAATCCGAGGCTA
>probe:Drosophila_2:1624101_at:200:571; Interrogation_Position=1433; Antisense; GGCTATAAGTTCAGTGTGTCCACAG
>probe:Drosophila_2:1624101_at:332:163; Interrogation_Position=1464; Antisense; AAATTCCCATGAAGTTTGTCGTGAA
>probe:Drosophila_2:1624101_at:520:173; Interrogation_Position=1488; Antisense; AAAGCATTCTTCTGTCTGCTGAGAA
>probe:Drosophila_2:1624101_at:35:423; Interrogation_Position=1508; Antisense; GAGAATGGCATTCACCTTAAAGTTG
>probe:Drosophila_2:1624101_at:181:423; Interrogation_Position=1532; Antisense; GAGAAGCTTTCCAAATGAGACTATA
>probe:Drosophila_2:1624101_at:501:19; Interrogation_Position=1600; Antisense; ATTTGGTCATTTATTCACGGCTATA
>probe:Drosophila_2:1624101_at:380:235; Interrogation_Position=1643; Antisense; AATCCCTCTTAAAGCTCATATTCAG

Paste this into a BLAST search page for me
TGATCCCAGCTCTTGGTATTCACTAGAAATCTATCCCGAACCGGAGAAGTGTTCAAGCCGGAGCGATTTACGGATATTTACGGATGAGGCGATCGCCGCGCTGGCTGCCGTTTGGAGAAGGTCCCATCGGTCTTCGGTTTGGACTGATGCGATTGGCCTATCTAATCCGAGGCTAGGCTATAAGTTCAGTGTGTCCACAGAAATTCCCATGAAGTTTGTCGTGAAAAAGCATTCTTCTGTCTGCTGAGAAGAGAATGGCATTCACCTTAAAGTTGGAGAAGCTTTCCAAATGAGACTATAATTTGGTCATTTATTCACGGCTATAAATCCCTCTTAAAGCTCATATTCAG

Full Affymetrix probeset data:

Annotations for 1624101_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720