Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624103_at:

>probe:Drosophila_2:1624103_at:665:11; Interrogation_Position=1443; Antisense; ATTCTGTATTATCGCACTCGGCAGG
>probe:Drosophila_2:1624103_at:382:145; Interrogation_Position=1458; Antisense; ACTCGGCAGGATAGCTTGGGCGCAC
>probe:Drosophila_2:1624103_at:655:323; Interrogation_Position=1477; Antisense; GCGCACGCCGGCTGGATGAGATCTA
>probe:Drosophila_2:1624103_at:627:57; Interrogation_Position=1492; Antisense; ATGAGATCTACGGTCTCGCCTGCAA
>probe:Drosophila_2:1624103_at:114:243; Interrogation_Position=1531; Antisense; AATTTGGTGAGCTGCGCTCCGATTA
>probe:Drosophila_2:1624103_at:525:337; Interrogation_Position=1546; Antisense; GCTCCGATTATTTGCGCTATCTGTG
>probe:Drosophila_2:1624103_at:269:615; Interrogation_Position=1645; Antisense; TGCACCGCCAAATGGTTCAGCTGGA
>probe:Drosophila_2:1624103_at:135:165; Interrogation_Position=1704; Antisense; AAATACTGGCGCATGTGCTACGACT
>probe:Drosophila_2:1624103_at:464:597; Interrogation_Position=1717; Antisense; TGTGCTACGACTTTATGGCCTGCTA
>probe:Drosophila_2:1624103_at:375:69; Interrogation_Position=1731; Antisense; ATGGCCTGCTATTTCGGCAAGACAC
>probe:Drosophila_2:1624103_at:173:725; Interrogation_Position=1766; Antisense; TTGGGTGGAGTATCTCGCCTTCGAG
>probe:Drosophila_2:1624103_at:615:677; Interrogation_Position=1849; Antisense; TAGAGCCTCAATATGTCGCCGCGTT
>probe:Drosophila_2:1624103_at:527:509; Interrogation_Position=1899; Antisense; GTGGGCGCATCGATATAGTTGGCTA
>probe:Drosophila_2:1624103_at:578:501; Interrogation_Position=1970; Antisense; GTCGATCTTTCGGACTGTCTATAGT

Paste this into a BLAST search page for me
ATTCTGTATTATCGCACTCGGCAGGACTCGGCAGGATAGCTTGGGCGCACGCGCACGCCGGCTGGATGAGATCTAATGAGATCTACGGTCTCGCCTGCAAAATTTGGTGAGCTGCGCTCCGATTAGCTCCGATTATTTGCGCTATCTGTGTGCACCGCCAAATGGTTCAGCTGGAAAATACTGGCGCATGTGCTACGACTTGTGCTACGACTTTATGGCCTGCTAATGGCCTGCTATTTCGGCAAGACACTTGGGTGGAGTATCTCGCCTTCGAGTAGAGCCTCAATATGTCGCCGCGTTGTGGGCGCATCGATATAGTTGGCTAGTCGATCTTTCGGACTGTCTATAGT

Full Affymetrix probeset data:

Annotations for 1624103_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime