FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624105_at:

>probe:Drosophila_2:1624105_at:721:245; Interrogation_Position=1017; Antisense; AATTACTATGTGCTTTCCTGTGATC
>probe:Drosophila_2:1624105_at:559:595; Interrogation_Position=457; Antisense; TGTGTTTGTCTATCTGCTTCTGAAG
>probe:Drosophila_2:1624105_at:288:621; Interrogation_Position=545; Antisense; TGCTCGCTGCAATCTTATGCCCAGA
>probe:Drosophila_2:1624105_at:470:349; Interrogation_Position=577; Antisense; GCAGGATCGCCGGTCATCAAAAGGT
>probe:Drosophila_2:1624105_at:725:643; Interrogation_Position=614; Antisense; TCTTTGCCAAAGTTTTAGCTCGCTG
>probe:Drosophila_2:1624105_at:277:627; Interrogation_Position=648; Antisense; TGCCTAGCCTATTACACCGTGTTAA
>probe:Drosophila_2:1624105_at:211:601; Interrogation_Position=724; Antisense; TGTACTGAACTAGCCAATCTTCTCT
>probe:Drosophila_2:1624105_at:566:237; Interrogation_Position=739; Antisense; AATCTTCTCTACTCTAAAGCACCAG
>probe:Drosophila_2:1624105_at:417:351; Interrogation_Position=757; Antisense; GCACCAGTTTTCTGACTTTTTCGGA
>probe:Drosophila_2:1624105_at:456:467; Interrogation_Position=791; Antisense; GTTGTGTATTGTGTATCTCTCGTCT
>probe:Drosophila_2:1624105_at:544:285; Interrogation_Position=814; Antisense; CTGTCCTCAATCTCTATACATCTAT
>probe:Drosophila_2:1624105_at:660:29; Interrogation_Position=837; Antisense; ATACATCTGTACATCGCACTTTTCG
>probe:Drosophila_2:1624105_at:527:717; Interrogation_Position=858; Antisense; TTCGGGCTCGATTATGCGTTTGATA
>probe:Drosophila_2:1624105_at:124:597; Interrogation_Position=885; Antisense; TGTGTTTTTGAACGACCTCCACTGT

Paste this into a BLAST search page for me
AATTACTATGTGCTTTCCTGTGATCTGTGTTTGTCTATCTGCTTCTGAAGTGCTCGCTGCAATCTTATGCCCAGAGCAGGATCGCCGGTCATCAAAAGGTTCTTTGCCAAAGTTTTAGCTCGCTGTGCCTAGCCTATTACACCGTGTTAATGTACTGAACTAGCCAATCTTCTCTAATCTTCTCTACTCTAAAGCACCAGGCACCAGTTTTCTGACTTTTTCGGAGTTGTGTATTGTGTATCTCTCGTCTCTGTCCTCAATCTCTATACATCTATATACATCTGTACATCGCACTTTTCGTTCGGGCTCGATTATGCGTTTGATATGTGTTTTTGAACGACCTCCACTGT

Full Affymetrix probeset data:

Annotations for 1624105_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720