Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624106_at:

>probe:Drosophila_2:1624106_at:279:621; Interrogation_Position=1423; Antisense; TGCTGCTCTACTGCGTGGGCAAGAT
>probe:Drosophila_2:1624106_at:643:31; Interrogation_Position=1452; Antisense; ATAAGCTCGTCCTTTGTAGTCTTGC
>probe:Drosophila_2:1624106_at:613:37; Interrogation_Position=1487; Antisense; ATCTGAACTGTATCCCACGGTGGTG
>probe:Drosophila_2:1624106_at:676:341; Interrogation_Position=1528; Antisense; GCTTTAGCTCGGTAATATCCATGGT
>probe:Drosophila_2:1624106_at:145:167; Interrogation_Position=1594; Antisense; AAATGCTCGTACTTCCGCTAATTGT
>probe:Drosophila_2:1624106_at:441:553; Interrogation_Position=1623; Antisense; GGAGCCCTGCTAATCTTGGGAGGAT
>probe:Drosophila_2:1624106_at:38:461; Interrogation_Position=1645; Antisense; GATTTGCTAGTCTTTTGCTGCCAGA
>probe:Drosophila_2:1624106_at:656:491; Interrogation_Position=1675; Antisense; GTAACCGAAATCTTCCACAGACTTT
>probe:Drosophila_2:1624106_at:609:123; Interrogation_Position=1762; Antisense; AGCCGAACAATATCCGTGCGAGTCC
>probe:Drosophila_2:1624106_at:510:221; Interrogation_Position=1793; Antisense; AAGGATTCTTCCTGAGGCCGGAACA
>probe:Drosophila_2:1624106_at:128:561; Interrogation_Position=1812; Antisense; GGAACACCGGTTTTCCATCGTGTAG
>probe:Drosophila_2:1624106_at:177:271; Interrogation_Position=1827; Antisense; CATCGTGTAGATACTCCGGTTTCAG
>probe:Drosophila_2:1624106_at:199:303; Interrogation_Position=1842; Antisense; CCGGTTTCAGATAGAGTCCCTTGCA
>probe:Drosophila_2:1624106_at:332:395; Interrogation_Position=1893; Antisense; GAAATGCGCACACTTTAGTCAGTTA

Paste this into a BLAST search page for me
TGCTGCTCTACTGCGTGGGCAAGATATAAGCTCGTCCTTTGTAGTCTTGCATCTGAACTGTATCCCACGGTGGTGGCTTTAGCTCGGTAATATCCATGGTAAATGCTCGTACTTCCGCTAATTGTGGAGCCCTGCTAATCTTGGGAGGATGATTTGCTAGTCTTTTGCTGCCAGAGTAACCGAAATCTTCCACAGACTTTAGCCGAACAATATCCGTGCGAGTCCAAGGATTCTTCCTGAGGCCGGAACAGGAACACCGGTTTTCCATCGTGTAGCATCGTGTAGATACTCCGGTTTCAGCCGGTTTCAGATAGAGTCCCTTGCAGAAATGCGCACACTTTAGTCAGTTA

Full Affymetrix probeset data:

Annotations for 1624106_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime