Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624108_at:

>probe:Drosophila_2:1624108_at:695:319; Interrogation_Position=1017; Antisense; GCCCACGTACGACTACGATTACTTT
>probe:Drosophila_2:1624108_at:55:405; Interrogation_Position=1027; Antisense; GACTACGATTACTTTGAGGAGCCAA
>probe:Drosophila_2:1624108_at:292:437; Interrogation_Position=1042; Antisense; GAGGAGCCAACGATATATGCGCAAA
>probe:Drosophila_2:1624108_at:442:251; Interrogation_Position=1077; Antisense; CAAGACGATGCAGGTGGACACAGGA
>probe:Drosophila_2:1624108_at:40:517; Interrogation_Position=1198; Antisense; GTGTCGCCTGGAACCGTGCAAATGT
>probe:Drosophila_2:1624108_at:640:561; Interrogation_Position=1207; Antisense; GGAACCGTGCAAATGTACACCCTGC
>probe:Drosophila_2:1624108_at:128:265; Interrogation_Position=1303; Antisense; CAGAACTCCGCTTCGATGATGCAAA
>probe:Drosophila_2:1624108_at:3:113; Interrogation_Position=1427; Antisense; AGCAAATGGCCCATGGCCAGATGCT
>probe:Drosophila_2:1624108_at:558:577; Interrogation_Position=1441; Antisense; GGCCAGATGCTGGTATCGAGCAACA
>probe:Drosophila_2:1624108_at:337:681; Interrogation_Position=1454; Antisense; TATCGAGCAACAGCAGCGGATTGGC
>probe:Drosophila_2:1624108_at:119:519; Interrogation_Position=1495; Antisense; GTGGCCAGTCCCAGTAGCTCATTAT
>probe:Drosophila_2:1624108_at:158:91; Interrogation_Position=1507; Antisense; AGTAGCTCATTATCGGGACTCTCGG
>probe:Drosophila_2:1624108_at:670:517; Interrogation_Position=1534; Antisense; GTGGGCAAGTCCTATTCGCGCGAAA
>probe:Drosophila_2:1624108_at:140:689; Interrogation_Position=1546; Antisense; TATTCGCGCGAAATAGTCACCGTTC

Paste this into a BLAST search page for me
GCCCACGTACGACTACGATTACTTTGACTACGATTACTTTGAGGAGCCAAGAGGAGCCAACGATATATGCGCAAACAAGACGATGCAGGTGGACACAGGAGTGTCGCCTGGAACCGTGCAAATGTGGAACCGTGCAAATGTACACCCTGCCAGAACTCCGCTTCGATGATGCAAAAGCAAATGGCCCATGGCCAGATGCTGGCCAGATGCTGGTATCGAGCAACATATCGAGCAACAGCAGCGGATTGGCGTGGCCAGTCCCAGTAGCTCATTATAGTAGCTCATTATCGGGACTCTCGGGTGGGCAAGTCCTATTCGCGCGAAATATTCGCGCGAAATAGTCACCGTTC

Full Affymetrix probeset data:

Annotations for 1624108_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime