Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624110_at:

>probe:Drosophila_2:1624110_at:370:399; Interrogation_Position=1486; Antisense; GACACGACGCGCTACAAATCGGGAT
>probe:Drosophila_2:1624110_at:267:425; Interrogation_Position=1532; Antisense; GAGACGTTGATGGTCGGCCGACTTC
>probe:Drosophila_2:1624110_at:702:603; Interrogation_Position=1572; Antisense; TGTTGTGGCAACTGGCGCTCCGAGC
>probe:Drosophila_2:1624110_at:176:277; Interrogation_Position=1592; Antisense; CGAGCGTTTTTAGCACCGGTTGTGC
>probe:Drosophila_2:1624110_at:162:563; Interrogation_Position=1642; Antisense; GGAAGCAATGTTGCCGCTGCACTTG
>probe:Drosophila_2:1624110_at:146:255; Interrogation_Position=1715; Antisense; CAACGGGAGCAACATCGCCAGGCAG
>probe:Drosophila_2:1624110_at:425:211; Interrogation_Position=1759; Antisense; AAGAAATTCTTAAGCCAGGCGGCGC
>probe:Drosophila_2:1624110_at:164:245; Interrogation_Position=1814; Antisense; AATTTGCCGATAAGGCCGACTCCGA
>probe:Drosophila_2:1624110_at:683:353; Interrogation_Position=1846; Antisense; GCACTGGACAATCTGGACCTGGCTC
>probe:Drosophila_2:1624110_at:9:263; Interrogation_Position=1872; Antisense; CAGCCTGGATTTATTGGACGTCGAC
>probe:Drosophila_2:1624110_at:107:545; Interrogation_Position=1902; Antisense; GGATCCGTACGGAGCTTTGCAGGAT
>probe:Drosophila_2:1624110_at:350:119; Interrogation_Position=1934; Antisense; AGCGTGTCAAGGTGAGTGCCTCTGA
>probe:Drosophila_2:1624110_at:695:505; Interrogation_Position=1949; Antisense; GTGCCTCTGATGTTGTTTTGTTACT
>probe:Drosophila_2:1624110_at:231:233; Interrogation_Position=1984; Antisense; AATGCAGAGCTGTTTCGTTCCCAAG

Paste this into a BLAST search page for me
GACACGACGCGCTACAAATCGGGATGAGACGTTGATGGTCGGCCGACTTCTGTTGTGGCAACTGGCGCTCCGAGCCGAGCGTTTTTAGCACCGGTTGTGCGGAAGCAATGTTGCCGCTGCACTTGCAACGGGAGCAACATCGCCAGGCAGAAGAAATTCTTAAGCCAGGCGGCGCAATTTGCCGATAAGGCCGACTCCGAGCACTGGACAATCTGGACCTGGCTCCAGCCTGGATTTATTGGACGTCGACGGATCCGTACGGAGCTTTGCAGGATAGCGTGTCAAGGTGAGTGCCTCTGAGTGCCTCTGATGTTGTTTTGTTACTAATGCAGAGCTGTTTCGTTCCCAAG

Full Affymetrix probeset data:

Annotations for 1624110_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime