FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624113_at:

>probe:Drosophila_2:1624113_at:152:609; Interrogation_Position=1015; Antisense; TGAGCTCTGCAAGCCTAGACCGATA
>probe:Drosophila_2:1624113_at:330:455; Interrogation_Position=1036; Antisense; GATACGTTCGTATCCATGATTCCGA
>probe:Drosophila_2:1624113_at:293:59; Interrogation_Position=1051; Antisense; ATGATTCCGAAACCACAGTGCTGCT
>probe:Drosophila_2:1624113_at:509:335; Interrogation_Position=1070; Antisense; GCTGCTCTACCAATGCTACGTGAAA
>probe:Drosophila_2:1624113_at:177:659; Interrogation_Position=1106; Antisense; TAAGATTCTTATCCGACCGTTTGAA
>probe:Drosophila_2:1624113_at:686:107; Interrogation_Position=1151; Antisense; AGAACCTGAGGAGGTCGCTGACCTT
>probe:Drosophila_2:1624113_at:720:121; Interrogation_Position=1206; Antisense; AGCGTCAACGCAACATCTGTGGACA
>probe:Drosophila_2:1624113_at:100:545; Interrogation_Position=1241; Antisense; GGATATGTTTGATCAGATGCCCACT
>probe:Drosophila_2:1624113_at:425:625; Interrogation_Position=1258; Antisense; TGCCCACTGTGGGTGACAGCGATAA
>probe:Drosophila_2:1624113_at:711:663; Interrogation_Position=888; Antisense; TACACGGGTACCACAATGGGTGCTC
>probe:Drosophila_2:1624113_at:544:531; Interrogation_Position=905; Antisense; GGGTGCTCTAAAAGCCTTTGACACT
>probe:Drosophila_2:1624113_at:649:689; Interrogation_Position=921; Antisense; TTTGACACTCGACGCATGAAAACTC
>probe:Drosophila_2:1624113_at:197:291; Interrogation_Position=955; Antisense; CGTACAAGGGATTCACAGGCGGGAT
>probe:Drosophila_2:1624113_at:496:511; Interrogation_Position=982; Antisense; GTGACCTTCATTTAGATGCCACCGG

Paste this into a BLAST search page for me
TGAGCTCTGCAAGCCTAGACCGATAGATACGTTCGTATCCATGATTCCGAATGATTCCGAAACCACAGTGCTGCTGCTGCTCTACCAATGCTACGTGAAATAAGATTCTTATCCGACCGTTTGAAAGAACCTGAGGAGGTCGCTGACCTTAGCGTCAACGCAACATCTGTGGACAGGATATGTTTGATCAGATGCCCACTTGCCCACTGTGGGTGACAGCGATAATACACGGGTACCACAATGGGTGCTCGGGTGCTCTAAAAGCCTTTGACACTTTTGACACTCGACGCATGAAAACTCCGTACAAGGGATTCACAGGCGGGATGTGACCTTCATTTAGATGCCACCGG

Full Affymetrix probeset data:

Annotations for 1624113_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720