Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624114_at:

>probe:Drosophila_2:1624114_at:681:103; Interrogation_Position=1466; Antisense; AGACGCGCCTGGAAGGATCCGAGAT
>probe:Drosophila_2:1624114_at:156:535; Interrogation_Position=1506; Antisense; GGTCCTCAAGGAATGCATTCGCGCT
>probe:Drosophila_2:1624114_at:33:89; Interrogation_Position=1541; Antisense; AGTCGAGTCATTTGCCATTCCGTGG
>probe:Drosophila_2:1624114_at:493:621; Interrogation_Position=1586; Antisense; TGCGGGACTCCTTCATCGGAGGTAA
>probe:Drosophila_2:1624114_at:427:343; Interrogation_Position=1649; Antisense; GCTTGCATTCGGTGGAGCATACCTT
>probe:Drosophila_2:1624114_at:597:345; Interrogation_Position=1665; Antisense; GCATACCTTGAACACGCTGCGTTAT
>probe:Drosophila_2:1624114_at:379:221; Interrogation_Position=1710; Antisense; AAGTGTGGAGTCGATCCCATCTAAA
>probe:Drosophila_2:1624114_at:322:447; Interrogation_Position=1744; Antisense; GATGCCAACCTTGGAAGCACTTCCA
>probe:Drosophila_2:1624114_at:216:265; Interrogation_Position=1772; Antisense; CAGATATTGTTTGCCAGTCGTCCAC
>probe:Drosophila_2:1624114_at:374:325; Interrogation_Position=1873; Antisense; GCGAACGACTTGAACAGATCCCAGA
>probe:Drosophila_2:1624114_at:670:391; Interrogation_Position=1896; Antisense; GAAACCAACATCTAAGCCCACTTAT
>probe:Drosophila_2:1624114_at:361:253; Interrogation_Position=1963; Antisense; CAACGGGAGGCCTCCATGATGCTGA
>probe:Drosophila_2:1624114_at:3:59; Interrogation_Position=1978; Antisense; ATGATGCTGACCAAATCCCTGGCAC
>probe:Drosophila_2:1624114_at:540:563; Interrogation_Position=1998; Antisense; GGCACAATTCCGAGGGCGCAACTTT

Paste this into a BLAST search page for me
AGACGCGCCTGGAAGGATCCGAGATGGTCCTCAAGGAATGCATTCGCGCTAGTCGAGTCATTTGCCATTCCGTGGTGCGGGACTCCTTCATCGGAGGTAAGCTTGCATTCGGTGGAGCATACCTTGCATACCTTGAACACGCTGCGTTATAAGTGTGGAGTCGATCCCATCTAAAGATGCCAACCTTGGAAGCACTTCCACAGATATTGTTTGCCAGTCGTCCACGCGAACGACTTGAACAGATCCCAGAGAAACCAACATCTAAGCCCACTTATCAACGGGAGGCCTCCATGATGCTGAATGATGCTGACCAAATCCCTGGCACGGCACAATTCCGAGGGCGCAACTTT

Full Affymetrix probeset data:

Annotations for 1624114_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime