FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624116_at:

>probe:Drosophila_2:1624116_at:637:183; Interrogation_Position=1010; Antisense; AAAAGGTGCAGTATTCCTCCGGACT
>probe:Drosophila_2:1624116_at:103:395; Interrogation_Position=1076; Antisense; GAAATTGGCAGGACCGACTTGATAC
>probe:Drosophila_2:1624116_at:84:29; Interrogation_Position=1097; Antisense; ATACCGATTTGGAACACGCCGACGT
>probe:Drosophila_2:1624116_at:563:495; Interrogation_Position=1120; Antisense; GTCATGTGCACCGTATCAAGGCTTG
>probe:Drosophila_2:1624116_at:32:545; Interrogation_Position=1191; Antisense; GGATATGTATCTTCAGCGAATCAAA
>probe:Drosophila_2:1624116_at:144:511; Interrogation_Position=1219; Antisense; GTGCAAGCACTCATAGATCAGGAAA
>probe:Drosophila_2:1624116_at:439:241; Interrogation_Position=716; Antisense; AATACCACATGAATGCCCCTTGGGT
>probe:Drosophila_2:1624116_at:659:623; Interrogation_Position=729; Antisense; TGCCCCTTGGGTAAAGAGCCTTAAT
>probe:Drosophila_2:1624116_at:284:165; Interrogation_Position=765; Antisense; AAATCTGGCATCCAGTGCGTCAGTC
>probe:Drosophila_2:1624116_at:553:621; Interrogation_Position=780; Antisense; TGCGTCAGTCGCTTTGCTCAATGAG
>probe:Drosophila_2:1624116_at:543:169; Interrogation_Position=806; Antisense; AAAGTGGCTCCTTGACGTCGTTACG
>probe:Drosophila_2:1624116_at:488:475; Interrogation_Position=825; Antisense; GTTACGTCGTAACTCATCGGCAATG
>probe:Drosophila_2:1624116_at:248:165; Interrogation_Position=865; Antisense; AAATCAGCCCTGAACCCGATTGAAA
>probe:Drosophila_2:1624116_at:129:35; Interrogation_Position=926; Antisense; ATCAGCGTCTGACCCGGATGAACGA

Paste this into a BLAST search page for me
AAAAGGTGCAGTATTCCTCCGGACTGAAATTGGCAGGACCGACTTGATACATACCGATTTGGAACACGCCGACGTGTCATGTGCACCGTATCAAGGCTTGGGATATGTATCTTCAGCGAATCAAAGTGCAAGCACTCATAGATCAGGAAAAATACCACATGAATGCCCCTTGGGTTGCCCCTTGGGTAAAGAGCCTTAATAAATCTGGCATCCAGTGCGTCAGTCTGCGTCAGTCGCTTTGCTCAATGAGAAAGTGGCTCCTTGACGTCGTTACGGTTACGTCGTAACTCATCGGCAATGAAATCAGCCCTGAACCCGATTGAAAATCAGCGTCTGACCCGGATGAACGA

Full Affymetrix probeset data:

Annotations for 1624116_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720