Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624117_at:

>probe:Drosophila_2:1624117_at:423:425; Interrogation_Position=5551; Antisense; GAGAGTTCCTCAGCAAGGACTTCGA
>probe:Drosophila_2:1624117_at:97:403; Interrogation_Position=5568; Antisense; GACTTCGATTTGACGTTCCTAGATG
>probe:Drosophila_2:1624117_at:299:409; Interrogation_Position=5579; Antisense; GACGTTCCTAGATGAGTACAGCAAA
>probe:Drosophila_2:1624117_at:116:663; Interrogation_Position=5641; Antisense; TAAACAGCCGCACCAAAGACAAAAT
>probe:Drosophila_2:1624117_at:515:171; Interrogation_Position=5655; Antisense; AAAGACAAAATCAGCGCCGGTAATA
>probe:Drosophila_2:1624117_at:77:321; Interrogation_Position=5705; Antisense; GCGCGAGGGCGGCAACTTAATATAT
>probe:Drosophila_2:1624117_at:345:255; Interrogation_Position=5749; Antisense; CATACAATGATCCTTCAACCTGAAG
>probe:Drosophila_2:1624117_at:393:375; Interrogation_Position=5770; Antisense; GAAGACCCAGCTTTCTAAGTGATAT
>probe:Drosophila_2:1624117_at:550:191; Interrogation_Position=5873; Antisense; AACTTTGAATGCAGAAGCGGCACTC
>probe:Drosophila_2:1624117_at:390:331; Interrogation_Position=5889; Antisense; GCGGCACTCAAAACAAACACTTGTA
>probe:Drosophila_2:1624117_at:679:661; Interrogation_Position=5936; Antisense; TAAACAATCACTTCATCTCACGCAC
>probe:Drosophila_2:1624117_at:480:281; Interrogation_Position=5960; Antisense; CTCTCACACATTCGCTAAACACATT
>probe:Drosophila_2:1624117_at:106:659; Interrogation_Position=6070; Antisense; TAAGCGATCCTATCAAACTCCTACC
>probe:Drosophila_2:1624117_at:504:239; Interrogation_Position=6118; Antisense; AATACCATCAACAGCTTTCACCAAT

Paste this into a BLAST search page for me
GAGAGTTCCTCAGCAAGGACTTCGAGACTTCGATTTGACGTTCCTAGATGGACGTTCCTAGATGAGTACAGCAAATAAACAGCCGCACCAAAGACAAAATAAAGACAAAATCAGCGCCGGTAATAGCGCGAGGGCGGCAACTTAATATATCATACAATGATCCTTCAACCTGAAGGAAGACCCAGCTTTCTAAGTGATATAACTTTGAATGCAGAAGCGGCACTCGCGGCACTCAAAACAAACACTTGTATAAACAATCACTTCATCTCACGCACCTCTCACACATTCGCTAAACACATTTAAGCGATCCTATCAAACTCCTACCAATACCATCAACAGCTTTCACCAAT

Full Affymetrix probeset data:

Annotations for 1624117_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime