FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624118_at:

>probe:Drosophila_2:1624118_at:141:507; Interrogation_Position=439; Antisense; GTGCGTAGATACACTGCTTCTAATG
>probe:Drosophila_2:1624118_at:102:477; Interrogation_Position=463; Antisense; GTTTTGATAATCCTCGTGGGCAACA
>probe:Drosophila_2:1624118_at:672:439; Interrogation_Position=526; Antisense; GAGGCGCGCCAGATGTGTCAATATA
>probe:Drosophila_2:1624118_at:667:687; Interrogation_Position=547; Antisense; TATATACCTGAGATCCTGTTCGTGA
>probe:Drosophila_2:1624118_at:566:497; Interrogation_Position=568; Antisense; GTGATGGAGACCTCCGCCAAGGAGA
>probe:Drosophila_2:1624118_at:294:171; Interrogation_Position=592; Antisense; AACATGAACGTGGAGGACGCCTTCC
>probe:Drosophila_2:1624118_at:63:663; Interrogation_Position=636; Antisense; TAAACGCCAACACGATGCCAACAAT
>probe:Drosophila_2:1624118_at:129:505; Interrogation_Position=670; Antisense; GTGCCAGAAAACACCATCACCTTGG
>probe:Drosophila_2:1624118_at:168:151; Interrogation_Position=686; Antisense; TCACCTTGGGCCAGGGAAAGCCTTT
>probe:Drosophila_2:1624118_at:4:265; Interrogation_Position=728; Antisense; CATGCAATCTCACCTAGACCTAAAT
>probe:Drosophila_2:1624118_at:406:663; Interrogation_Position=748; Antisense; TAAATCCGCTCTTTAGTTTGCTTTT
>probe:Drosophila_2:1624118_at:333:161; Interrogation_Position=887; Antisense; ACAATCTCACACATCAGCGAATCGA
>probe:Drosophila_2:1624118_at:337:325; Interrogation_Position=903; Antisense; GCGAATCGAGCCAACAATGTCAATT
>probe:Drosophila_2:1624118_at:389:241; Interrogation_Position=951; Antisense; AATACGTCCACTTCTCTATTTGTAA

Paste this into a BLAST search page for me
GTGCGTAGATACACTGCTTCTAATGGTTTTGATAATCCTCGTGGGCAACAGAGGCGCGCCAGATGTGTCAATATATATATACCTGAGATCCTGTTCGTGAGTGATGGAGACCTCCGCCAAGGAGAAACATGAACGTGGAGGACGCCTTCCTAAACGCCAACACGATGCCAACAATGTGCCAGAAAACACCATCACCTTGGTCACCTTGGGCCAGGGAAAGCCTTTCATGCAATCTCACCTAGACCTAAATTAAATCCGCTCTTTAGTTTGCTTTTACAATCTCACACATCAGCGAATCGAGCGAATCGAGCCAACAATGTCAATTAATACGTCCACTTCTCTATTTGTAA

Full Affymetrix probeset data:

Annotations for 1624118_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720