Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624121_at:

>probe:Drosophila_2:1624121_at:485:727; Interrogation_Position=2099; Antisense; TTGGTTATCACCGATGATCCCCAGG
>probe:Drosophila_2:1624121_at:501:517; Interrogation_Position=2124; Antisense; GTGGGTATGACCGACTGTCTGATGC
>probe:Drosophila_2:1624121_at:523:363; Interrogation_Position=2183; Antisense; GAATTCACCCGGAGAGGCAGGCCCA
>probe:Drosophila_2:1624121_at:245:507; Interrogation_Position=2230; Antisense; GTGCCTGTCCAGATATCCTCAAAAT
>probe:Drosophila_2:1624121_at:269:407; Interrogation_Position=2265; Antisense; GACTGGATGATAACTTCCCCACTTT
>probe:Drosophila_2:1624121_at:176:211; Interrogation_Position=2291; Antisense; AAGAAGTTCAATCGATCCCTCATCA
>probe:Drosophila_2:1624121_at:592:449; Interrogation_Position=2304; Antisense; GATCCCTCATCACCGAGTGTGTAGA
>probe:Drosophila_2:1624121_at:681:559; Interrogation_Position=2332; Antisense; GGAACCGGCTCTATTGGAAATTACA
>probe:Drosophila_2:1624121_at:712:245; Interrogation_Position=2350; Antisense; AATTACACCGAATATCACATGGCCG
>probe:Drosophila_2:1624121_at:243:153; Interrogation_Position=2366; Antisense; ACATGGCCGGATACTGTGTACTACA
>probe:Drosophila_2:1624121_at:692:159; Interrogation_Position=2388; Antisense; ACAACTCCTTTACCCATGGCAATAT
>probe:Drosophila_2:1624121_at:381:451; Interrogation_Position=2460; Antisense; GATCGATGGGCTTATCCTGGTCCTT
>probe:Drosophila_2:1624121_at:416:521; Interrogation_Position=2503; Antisense; GTGGCTCGTGCTCCAGAACTGACTG
>probe:Drosophila_2:1624121_at:288:383; Interrogation_Position=2518; Antisense; GAACTGACTGTTTTCTCATTCTTAG

Paste this into a BLAST search page for me
TTGGTTATCACCGATGATCCCCAGGGTGGGTATGACCGACTGTCTGATGCGAATTCACCCGGAGAGGCAGGCCCAGTGCCTGTCCAGATATCCTCAAAATGACTGGATGATAACTTCCCCACTTTAAGAAGTTCAATCGATCCCTCATCAGATCCCTCATCACCGAGTGTGTAGAGGAACCGGCTCTATTGGAAATTACAAATTACACCGAATATCACATGGCCGACATGGCCGGATACTGTGTACTACAACAACTCCTTTACCCATGGCAATATGATCGATGGGCTTATCCTGGTCCTTGTGGCTCGTGCTCCAGAACTGACTGGAACTGACTGTTTTCTCATTCTTAG

Full Affymetrix probeset data:

Annotations for 1624121_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime