Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624123_at:

>probe:Drosophila_2:1624123_at:573:407; Interrogation_Position=1469; Antisense; GACGGAACGTTTCGCACGGCAATAG
>probe:Drosophila_2:1624123_at:440:373; Interrogation_Position=1498; Antisense; GAAGTCTCGGAACTCTCGCATCTCA
>probe:Drosophila_2:1624123_at:487:633; Interrogation_Position=1526; Antisense; TCCGCGTGCTGATGCCCGGTGAAGA
>probe:Drosophila_2:1624123_at:711:547; Interrogation_Position=1551; Antisense; GGATGTGTCTCCAAAGGATCGGGAT
>probe:Drosophila_2:1624123_at:91:463; Interrogation_Position=1588; Antisense; GATTCCGGTATCAGGGAGACATCCA
>probe:Drosophila_2:1624123_at:382:401; Interrogation_Position=1605; Antisense; GACATCCAAATCTTTAGCTCTCTTT
>probe:Drosophila_2:1624123_at:158:683; Interrogation_Position=1784; Antisense; TATAAGTGGTTTCCCTGCTTACCCA
>probe:Drosophila_2:1624123_at:497:685; Interrogation_Position=1849; Antisense; TATCTGTATCTGAGGCGCCAATCTT
>probe:Drosophila_2:1624123_at:325:577; Interrogation_Position=1862; Antisense; GGCGCCAATCTTGAAGTGACTTTTA
>probe:Drosophila_2:1624123_at:301:611; Interrogation_Position=1878; Antisense; TGACTTTTATCTATCTGGCTGCCAA
>probe:Drosophila_2:1624123_at:522:491; Interrogation_Position=1903; Antisense; GTAAATTGACTTATCGCCACTGCGA
>probe:Drosophila_2:1624123_at:427:415; Interrogation_Position=1938; Antisense; GAGCCAATGTTTGCCCATTTCGAGA
>probe:Drosophila_2:1624123_at:665:493; Interrogation_Position=1992; Antisense; GTAATTTATGTTCATGTCGCCAGTG
>probe:Drosophila_2:1624123_at:448:503; Interrogation_Position=2007; Antisense; GTCGCCAGTGATTGAGCGGACCTGA

Paste this into a BLAST search page for me
GACGGAACGTTTCGCACGGCAATAGGAAGTCTCGGAACTCTCGCATCTCATCCGCGTGCTGATGCCCGGTGAAGAGGATGTGTCTCCAAAGGATCGGGATGATTCCGGTATCAGGGAGACATCCAGACATCCAAATCTTTAGCTCTCTTTTATAAGTGGTTTCCCTGCTTACCCATATCTGTATCTGAGGCGCCAATCTTGGCGCCAATCTTGAAGTGACTTTTATGACTTTTATCTATCTGGCTGCCAAGTAAATTGACTTATCGCCACTGCGAGAGCCAATGTTTGCCCATTTCGAGAGTAATTTATGTTCATGTCGCCAGTGGTCGCCAGTGATTGAGCGGACCTGA

Full Affymetrix probeset data:

Annotations for 1624123_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime