Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624124_at:

>probe:Drosophila_2:1624124_at:558:491; Interrogation_Position=1197; Antisense; GTAACTCCGTGCTGAGGATGCCGCG
>probe:Drosophila_2:1624124_at:541:447; Interrogation_Position=1213; Antisense; GATGCCGCGCGGAAAGCTTGTAGAT
>probe:Drosophila_2:1624124_at:519:485; Interrogation_Position=1239; Antisense; GTAGATCCCTATACGGAGGACCCGT
>probe:Drosophila_2:1624124_at:661:215; Interrogation_Position=1313; Antisense; AAGATATCCCATTTCGGCGATGACT
>probe:Drosophila_2:1624124_at:503:609; Interrogation_Position=1333; Antisense; TGACTTTCACACCTACAGCTTGGAT
>probe:Drosophila_2:1624124_at:678:241; Interrogation_Position=1367; Antisense; AATAGGCTGCTCTTCTCCGTAGATG
>probe:Drosophila_2:1624124_at:113:309; Interrogation_Position=1464; Antisense; CCATGGCCCCGTTCGATAAAATGTT
>probe:Drosophila_2:1624124_at:526:601; Interrogation_Position=1485; Antisense; TGTTTTACATTTCGTTGGGCGTCTC
>probe:Drosophila_2:1624124_at:33:643; Interrogation_Position=1506; Antisense; TCTCTGTGGGCGGATTTGGTGACTT
>probe:Drosophila_2:1624124_at:718:533; Interrogation_Position=1523; Antisense; GGTGACTTTGTGGACCATCTTCGCA
>probe:Drosophila_2:1624124_at:543:347; Interrogation_Position=1545; Antisense; GCACCGCCACTTATGAGAAGCCTTG
>probe:Drosophila_2:1624124_at:575:389; Interrogation_Position=1636; Antisense; GAAACAGCCGGCCTTGAAGATCGAT
>probe:Drosophila_2:1624124_at:485:291; Interrogation_Position=1667; Antisense; CGTGTCTTCGCCAACTGATAACTAA
>probe:Drosophila_2:1624124_at:657:509; Interrogation_Position=1732; Antisense; GTGAACGTGCCGATCGAAATCTATA

Paste this into a BLAST search page for me
GTAACTCCGTGCTGAGGATGCCGCGGATGCCGCGCGGAAAGCTTGTAGATGTAGATCCCTATACGGAGGACCCGTAAGATATCCCATTTCGGCGATGACTTGACTTTCACACCTACAGCTTGGATAATAGGCTGCTCTTCTCCGTAGATGCCATGGCCCCGTTCGATAAAATGTTTGTTTTACATTTCGTTGGGCGTCTCTCTCTGTGGGCGGATTTGGTGACTTGGTGACTTTGTGGACCATCTTCGCAGCACCGCCACTTATGAGAAGCCTTGGAAACAGCCGGCCTTGAAGATCGATCGTGTCTTCGCCAACTGATAACTAAGTGAACGTGCCGATCGAAATCTATA

Full Affymetrix probeset data:

Annotations for 1624124_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime