Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624125_at:

>probe:Drosophila_2:1624125_at:637:483; Interrogation_Position=15668; Antisense; GTAGATCCTAAGTAATGCCATTTTA
>probe:Drosophila_2:1624125_at:225:237; Interrogation_Position=15781; Antisense; AATCTTATGAGAACGCCTTGTATCA
>probe:Drosophila_2:1624125_at:352:537; Interrogation_Position=15807; Antisense; GGTCAACCATCCTAAAGTGCACTTT
>probe:Drosophila_2:1624125_at:556:499; Interrogation_Position=15823; Antisense; GTGCACTTTCTGTTAAGGGTTCGAA
>probe:Drosophila_2:1624125_at:391:197; Interrogation_Position=15866; Antisense; AACGACTGATATGTACTTCCGTACA
>probe:Drosophila_2:1624125_at:191:631; Interrogation_Position=15883; Antisense; TCCGTACATTATTAACACACCCAGT
>probe:Drosophila_2:1624125_at:499:17; Interrogation_Position=15926; Antisense; ATTTCGATTTCTGTACTTGTGTATA
>probe:Drosophila_2:1624125_at:386:727; Interrogation_Position=15942; Antisense; TTGTGTATATGTTTTCCGAGTGCTA
>probe:Drosophila_2:1624125_at:153:215; Interrogation_Position=15971; Antisense; AAGATAGTTTCAGCACCAGTGTGTA
>probe:Drosophila_2:1624125_at:607:267; Interrogation_Position=15987; Antisense; CAGTGTGTATTGATTTGTGTCGCCA
>probe:Drosophila_2:1624125_at:548:515; Interrogation_Position=16003; Antisense; GTGTCGCCATTTAAGTACATTCTAA
>probe:Drosophila_2:1624125_at:25:703; Interrogation_Position=16040; Antisense; TTATTGACAATCTCGCCAACATTCC
>probe:Drosophila_2:1624125_at:503:657; Interrogation_Position=16066; Antisense; TAACTGCCTTAGTCGTACTTATAGA
>probe:Drosophila_2:1624125_at:411:455; Interrogation_Position=16105; Antisense; GATACTTCGCATTCCTCTAGATATA

Paste this into a BLAST search page for me
GTAGATCCTAAGTAATGCCATTTTAAATCTTATGAGAACGCCTTGTATCAGGTCAACCATCCTAAAGTGCACTTTGTGCACTTTCTGTTAAGGGTTCGAAAACGACTGATATGTACTTCCGTACATCCGTACATTATTAACACACCCAGTATTTCGATTTCTGTACTTGTGTATATTGTGTATATGTTTTCCGAGTGCTAAAGATAGTTTCAGCACCAGTGTGTACAGTGTGTATTGATTTGTGTCGCCAGTGTCGCCATTTAAGTACATTCTAATTATTGACAATCTCGCCAACATTCCTAACTGCCTTAGTCGTACTTATAGAGATACTTCGCATTCCTCTAGATATA

Full Affymetrix probeset data:

Annotations for 1624125_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime