Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624126_at:

>probe:Drosophila_2:1624126_at:14:391; Interrogation_Position=1593; Antisense; GAAACCTTTTCGCATTTTTGCAAGA
>probe:Drosophila_2:1624126_at:730:429; Interrogation_Position=1630; Antisense; GAGTCAAGCGACGTCCGTTGGACAA
>probe:Drosophila_2:1624126_at:603:217; Interrogation_Position=1695; Antisense; AAGTACACCTGGCACTTTGCGAGTC
>probe:Drosophila_2:1624126_at:730:137; Interrogation_Position=1753; Antisense; ACGTACAGCTGCAGTTGGATCGCGC
>probe:Drosophila_2:1624126_at:301:45; Interrogation_Position=1789; Antisense; ATGCAGAAGGTCACTTCGTTCCCTA
>probe:Drosophila_2:1624126_at:496:375; Interrogation_Position=1853; Antisense; GAAGAAGCGTATAGTCTACCCGAGA
>probe:Drosophila_2:1624126_at:585:671; Interrogation_Position=1869; Antisense; TACCCGAGACTCAGCCTTTATATGG
>probe:Drosophila_2:1624126_at:415:215; Interrogation_Position=1896; Antisense; AAGATACTCTTCGAAGCGGCACCAA
>probe:Drosophila_2:1624126_at:327:147; Interrogation_Position=1924; Antisense; ACTACGTCGGCAATGGAGTCCTGGT
>probe:Drosophila_2:1624126_at:442:495; Interrogation_Position=1947; Antisense; GTCACCTGGACACCGGATGTTTTGC
>probe:Drosophila_2:1624126_at:614:261; Interrogation_Position=1976; Antisense; CAGCCAGTTCGGGTTGATGCACGTG
>probe:Drosophila_2:1624126_at:608:139; Interrogation_Position=2018; Antisense; ACGTCCGCCCAGATAGGGTGAGCTT
>probe:Drosophila_2:1624126_at:423:411; Interrogation_Position=2065; Antisense; GACGCTTTCAATGTTGTCTGTTCCA
>probe:Drosophila_2:1624126_at:296:499; Interrogation_Position=2080; Antisense; GTCTGTTCCATGTATCTTTAGTCCA

Paste this into a BLAST search page for me
GAAACCTTTTCGCATTTTTGCAAGAGAGTCAAGCGACGTCCGTTGGACAAAAGTACACCTGGCACTTTGCGAGTCACGTACAGCTGCAGTTGGATCGCGCATGCAGAAGGTCACTTCGTTCCCTAGAAGAAGCGTATAGTCTACCCGAGATACCCGAGACTCAGCCTTTATATGGAAGATACTCTTCGAAGCGGCACCAAACTACGTCGGCAATGGAGTCCTGGTGTCACCTGGACACCGGATGTTTTGCCAGCCAGTTCGGGTTGATGCACGTGACGTCCGCCCAGATAGGGTGAGCTTGACGCTTTCAATGTTGTCTGTTCCAGTCTGTTCCATGTATCTTTAGTCCA

Full Affymetrix probeset data:

Annotations for 1624126_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime