Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624128_at:

>probe:Drosophila_2:1624128_at:214:493; Interrogation_Position=524; Antisense; GTAATGAAAATAATCCTCGCCGAGA
>probe:Drosophila_2:1624128_at:633:281; Interrogation_Position=539; Antisense; CTCGCCGAGAAGATCCGCGGGTAAA
>probe:Drosophila_2:1624128_at:322:547; Interrogation_Position=570; Antisense; GGATGCGTGGAATTTACGCCCTCAA
>probe:Drosophila_2:1624128_at:281:99; Interrogation_Position=646; Antisense; AGATGGCTGCCAAATCCAACATCCA
>probe:Drosophila_2:1624128_at:400:685; Interrogation_Position=681; Antisense; TATCGTAACTTTGCCTACCCTGGCA
>probe:Drosophila_2:1624128_at:574:369; Interrogation_Position=717; Antisense; GAAGGATACGGAGCCCATATGGGTT
>probe:Drosophila_2:1624128_at:198:109; Interrogation_Position=750; Antisense; AGAACCAACATCAACCGAGCGAAGT
>probe:Drosophila_2:1624128_at:115:227; Interrogation_Position=803; Antisense; AAGGCGACGGAACTGACTCGACAAT
>probe:Drosophila_2:1624128_at:138:145; Interrogation_Position=818; Antisense; ACTCGACAATCGATGACTTTTTGGC
>probe:Drosophila_2:1624128_at:654:169; Interrogation_Position=843; Antisense; AAAGGTGGATCTCACTGTCGCGGAC
>probe:Drosophila_2:1624128_at:453:77; Interrogation_Position=878; Antisense; AGGATGGCCAGGTGGTCACCACAAT
>probe:Drosophila_2:1624128_at:505:225; Interrogation_Position=914; Antisense; AAGGACGCGTTCTAAGTGCCAGTTT
>probe:Drosophila_2:1624128_at:643:505; Interrogation_Position=929; Antisense; GTGCCAGTTTTGCACTGAGCAATGA
>probe:Drosophila_2:1624128_at:433:563; Interrogation_Position=972; Antisense; GGCAAACTATCAAAGTCGCACTGGA

Paste this into a BLAST search page for me
GTAATGAAAATAATCCTCGCCGAGACTCGCCGAGAAGATCCGCGGGTAAAGGATGCGTGGAATTTACGCCCTCAAAGATGGCTGCCAAATCCAACATCCATATCGTAACTTTGCCTACCCTGGCAGAAGGATACGGAGCCCATATGGGTTAGAACCAACATCAACCGAGCGAAGTAAGGCGACGGAACTGACTCGACAATACTCGACAATCGATGACTTTTTGGCAAAGGTGGATCTCACTGTCGCGGACAGGATGGCCAGGTGGTCACCACAATAAGGACGCGTTCTAAGTGCCAGTTTGTGCCAGTTTTGCACTGAGCAATGAGGCAAACTATCAAAGTCGCACTGGA

Full Affymetrix probeset data:

Annotations for 1624128_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime