Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624132_at:

>probe:Drosophila_2:1624132_at:440:27; Interrogation_Position=312; Antisense; ATAGCCAGATGCAGAAGTCCGTGAT
>probe:Drosophila_2:1624132_at:127:703; Interrogation_Position=352; Antisense; TTTTGTGAAGCACCTGTCGCTGCGA
>probe:Drosophila_2:1624132_at:10:35; Interrogation_Position=407; Antisense; ATCAAAGTCGATGGCCAGGAGCACG
>probe:Drosophila_2:1624132_at:228:143; Interrogation_Position=442; Antisense; ACTGGCCCAAATCTCTCGCAAGAAT
>probe:Drosophila_2:1624132_at:237:361; Interrogation_Position=459; Antisense; GCAAGAATCCCAAGACCATCATAGT
>probe:Drosophila_2:1624132_at:407:679; Interrogation_Position=480; Antisense; TAGTCAACATGATTGGCTTCCCGCA
>probe:Drosophila_2:1624132_at:183:433; Interrogation_Position=538; Antisense; GAGTGGCATGAACCTTAATCCCCAA
>probe:Drosophila_2:1624132_at:525:547; Interrogation_Position=565; Antisense; GGATGGCACTACACTGTTCATACCC
>probe:Drosophila_2:1624132_at:263:367; Interrogation_Position=631; Antisense; GAATGCCAAAGCTCTGTTCGTCAAA
>probe:Drosophila_2:1624132_at:401:45; Interrogation_Position=657; Antisense; ATCGCGATGCCATACGAGGCGTTCA
>probe:Drosophila_2:1624132_at:245:225; Interrogation_Position=725; Antisense; AAGGATGATGCCTTCGCCGCACAGG
>probe:Drosophila_2:1624132_at:373:333; Interrogation_Position=823; Antisense; GCTGGGCGATTAGGCCTAAGACCAA
>probe:Drosophila_2:1624132_at:392:659; Interrogation_Position=839; Antisense; TAAGACCAAGACTGATTCCGCTCCA
>probe:Drosophila_2:1624132_at:55:463; Interrogation_Position=852; Antisense; GATTCCGCTCCAAAAGCCTTAATAA

Paste this into a BLAST search page for me
ATAGCCAGATGCAGAAGTCCGTGATTTTTGTGAAGCACCTGTCGCTGCGAATCAAAGTCGATGGCCAGGAGCACGACTGGCCCAAATCTCTCGCAAGAATGCAAGAATCCCAAGACCATCATAGTTAGTCAACATGATTGGCTTCCCGCAGAGTGGCATGAACCTTAATCCCCAAGGATGGCACTACACTGTTCATACCCGAATGCCAAAGCTCTGTTCGTCAAAATCGCGATGCCATACGAGGCGTTCAAAGGATGATGCCTTCGCCGCACAGGGCTGGGCGATTAGGCCTAAGACCAATAAGACCAAGACTGATTCCGCTCCAGATTCCGCTCCAAAAGCCTTAATAA

Full Affymetrix probeset data:

Annotations for 1624132_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime