Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624134_a_at:

>probe:Drosophila_2:1624134_a_at:603:581; Interrogation_Position=1014; Antisense; TGGCTGGAAAGAGCAGCGCTCCCAT
>probe:Drosophila_2:1624134_a_at:555:7; Interrogation_Position=1040; Antisense; ATTCCAAAGGCCACAGCGGCATCAG
>probe:Drosophila_2:1624134_a_at:594:543; Interrogation_Position=1121; Antisense; GGATCTATGTGAATGCGCTTTTAAA
>probe:Drosophila_2:1624134_a_at:446:319; Interrogation_Position=688; Antisense; GCCCAATCACCTCAAGAAACAGTCG
>probe:Drosophila_2:1624134_a_at:230:389; Interrogation_Position=703; Antisense; GAAACAGTCGGTGCAGCTCGATACT
>probe:Drosophila_2:1624134_a_at:91:147; Interrogation_Position=750; Antisense; ACTACGAACTCAACAAGCCCATTGT
>probe:Drosophila_2:1624134_a_at:260:215; Interrogation_Position=776; Antisense; AAGATCGACTACAGCCACGTGCAAA
>probe:Drosophila_2:1624134_a_at:42:235; Interrogation_Position=799; Antisense; AATGCCGACGGCGAACCTGTGCACA
>probe:Drosophila_2:1624134_a_at:442:553; Interrogation_Position=826; Antisense; GGACGCCTCTGATTCTGGGTCAGGA
>probe:Drosophila_2:1624134_a_at:317:315; Interrogation_Position=857; Antisense; GCCGGATCTGGAGCTTTTAACTTCG
>probe:Drosophila_2:1624134_a_at:103:699; Interrogation_Position=872; Antisense; TTTAACTTCGACATAGCTGCTCCGG
>probe:Drosophila_2:1624134_a_at:394:119; Interrogation_Position=886; Antisense; AGCTGCTCCGGTGATCAATATCGAT
>probe:Drosophila_2:1624134_a_at:469:293; Interrogation_Position=907; Antisense; CGATCTGACGAATATCGTGGCCGGT
>probe:Drosophila_2:1624134_a_at:316:645; Interrogation_Position=962; Antisense; TCTATTGGATTACCAGCGGCCACGC

Paste this into a BLAST search page for me
TGGCTGGAAAGAGCAGCGCTCCCATATTCCAAAGGCCACAGCGGCATCAGGGATCTATGTGAATGCGCTTTTAAAGCCCAATCACCTCAAGAAACAGTCGGAAACAGTCGGTGCAGCTCGATACTACTACGAACTCAACAAGCCCATTGTAAGATCGACTACAGCCACGTGCAAAAATGCCGACGGCGAACCTGTGCACAGGACGCCTCTGATTCTGGGTCAGGAGCCGGATCTGGAGCTTTTAACTTCGTTTAACTTCGACATAGCTGCTCCGGAGCTGCTCCGGTGATCAATATCGATCGATCTGACGAATATCGTGGCCGGTTCTATTGGATTACCAGCGGCCACGC

Full Affymetrix probeset data:

Annotations for 1624134_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime