FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624135_at:

>probe:Drosophila_2:1624135_at:553:379; Interrogation_Position=1845; Antisense; GAACGAATTCCCACAGACTTGCGTG
>probe:Drosophila_2:1624135_at:211:729; Interrogation_Position=1906; Antisense; TTGGACATCAACAACGTCACCGTGG
>probe:Drosophila_2:1624135_at:676:687; Interrogation_Position=1959; Antisense; TATTCCGGTGACAACGCGATTCCAG
>probe:Drosophila_2:1624135_at:257:69; Interrogation_Position=1982; Antisense; AGGCCCGCATAATCGTGTTCAACGT
>probe:Drosophila_2:1624135_at:253:515; Interrogation_Position=1996; Antisense; GTGTTCAACGTCAAGGTGCCCATTA
>probe:Drosophila_2:1624135_at:543:235; Interrogation_Position=2051; Antisense; AATCCCTAATAGAGCCCGCCGTGGT
>probe:Drosophila_2:1624135_at:632:117; Interrogation_Position=2081; Antisense; AGCTGACCGCATCGATTCACAAGAG
>probe:Drosophila_2:1624135_at:444:109; Interrogation_Position=2123; Antisense; AGAAGAAGCCGCGTTGCCTGGGCAA
>probe:Drosophila_2:1624135_at:640:185; Interrogation_Position=2146; Antisense; AACAACTCGTGTGCCCTAGTGGAAC
>probe:Drosophila_2:1624135_at:38:105; Interrogation_Position=2182; Antisense; AGACCCATCTGCATCGAGCGGTATG
>probe:Drosophila_2:1624135_at:220:9; Interrogation_Position=2257; Antisense; ATTGCCGCCGGAATGGTCACCAAGA
>probe:Drosophila_2:1624135_at:709:127; Interrogation_Position=2275; Antisense; ACCAAGATCCGCTAGGTCGATGACC
>probe:Drosophila_2:1624135_at:189:57; Interrogation_Position=2294; Antisense; ATGACCGCGCTGGATTTTGTACGAA
>probe:Drosophila_2:1624135_at:121:715; Interrogation_Position=2414; Antisense; TTCGGTCTGACCATTTTAGCGGTAT

Paste this into a BLAST search page for me
GAACGAATTCCCACAGACTTGCGTGTTGGACATCAACAACGTCACCGTGGTATTCCGGTGACAACGCGATTCCAGAGGCCCGCATAATCGTGTTCAACGTGTGTTCAACGTCAAGGTGCCCATTAAATCCCTAATAGAGCCCGCCGTGGTAGCTGACCGCATCGATTCACAAGAGAGAAGAAGCCGCGTTGCCTGGGCAAAACAACTCGTGTGCCCTAGTGGAACAGACCCATCTGCATCGAGCGGTATGATTGCCGCCGGAATGGTCACCAAGAACCAAGATCCGCTAGGTCGATGACCATGACCGCGCTGGATTTTGTACGAATTCGGTCTGACCATTTTAGCGGTAT

Full Affymetrix probeset data:

Annotations for 1624135_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720