FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624137_at:

>probe:Drosophila_2:1624137_at:358:7; Interrogation_Position=416; Antisense; ATTGCCCTGCTGCACGTGAACGAGT
>probe:Drosophila_2:1624137_at:106:383; Interrogation_Position=433; Antisense; GAACGAGTCTTTCATCTTCAACGAG
>probe:Drosophila_2:1624137_at:401:625; Interrogation_Position=477; Antisense; TGCCCAGCCGTGAACAAGTCCATGA
>probe:Drosophila_2:1624137_at:531:71; Interrogation_Position=501; Antisense; AGGGAGAGACCCACCTGTACGGTTG
>probe:Drosophila_2:1624137_at:582:127; Interrogation_Position=531; Antisense; AGCCAAAGTCCTACATCTTCTCGGG
>probe:Drosophila_2:1624137_at:545:577; Interrogation_Position=554; Antisense; GGCGCCAAGACCCTGCAGACTGTGA
>probe:Drosophila_2:1624137_at:139:347; Interrogation_Position=568; Antisense; GCAGACTGTGACCACCCAAATTTTG
>probe:Drosophila_2:1624137_at:149:175; Interrogation_Position=624; Antisense; AAAGCGCTCCTATCGCTGAGTCCAA
>probe:Drosophila_2:1624137_at:566:421; Interrogation_Position=673; Antisense; GAGCAAGTCTGCATGCAACGGTGAC
>probe:Drosophila_2:1624137_at:475:585; Interrogation_Position=711; Antisense; TGGTTGTTGAGTTCACAAACGCCCC
>probe:Drosophila_2:1624137_at:355:151; Interrogation_Position=789; Antisense; ACATGCCTTCCATTTACACCAAGGT
>probe:Drosophila_2:1624137_at:483:223; Interrogation_Position=809; Antisense; AAGGTGTCGGCCTACATTGATTGGA
>probe:Drosophila_2:1624137_at:156:203; Interrogation_Position=835; Antisense; AACCAATATTCAGAGTGCCTACTAC
>probe:Drosophila_2:1624137_at:138:37; Interrogation_Position=897; Antisense; ATCTATTAGCCAGGATCGAAATCGC

Paste this into a BLAST search page for me
ATTGCCCTGCTGCACGTGAACGAGTGAACGAGTCTTTCATCTTCAACGAGTGCCCAGCCGTGAACAAGTCCATGAAGGGAGAGACCCACCTGTACGGTTGAGCCAAAGTCCTACATCTTCTCGGGGGCGCCAAGACCCTGCAGACTGTGAGCAGACTGTGACCACCCAAATTTTGAAAGCGCTCCTATCGCTGAGTCCAAGAGCAAGTCTGCATGCAACGGTGACTGGTTGTTGAGTTCACAAACGCCCCACATGCCTTCCATTTACACCAAGGTAAGGTGTCGGCCTACATTGATTGGAAACCAATATTCAGAGTGCCTACTACATCTATTAGCCAGGATCGAAATCGC

Full Affymetrix probeset data:

Annotations for 1624137_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720