FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624138_at:

>probe:Drosophila_2:1624138_at:323:55; Interrogation_Position=2078; Antisense; ATGAAGGCCTTGAGTGCCAGGCAAA
>probe:Drosophila_2:1624138_at:218:187; Interrogation_Position=2104; Antisense; AACAGTGAACCAAGACGACGACGAT
>probe:Drosophila_2:1624138_at:623:655; Interrogation_Position=2137; Antisense; TAATCTAGTGCTGTCCAAGGCGCTA
>probe:Drosophila_2:1624138_at:100:629; Interrogation_Position=2150; Antisense; TCCAAGGCGCTACTCACCGAGGAGG
>probe:Drosophila_2:1624138_at:335:653; Interrogation_Position=2176; Antisense; TCAATATGACAAGCAGCGATTCCGG
>probe:Drosophila_2:1624138_at:393:417; Interrogation_Position=2201; Antisense; GAGCTGGTCAAGAAGCGCCACAAAC
>probe:Drosophila_2:1624138_at:704:311; Interrogation_Position=2217; Antisense; GCCACAAACTGCAGCGCGAGAAGCT
>probe:Drosophila_2:1624138_at:503:433; Interrogation_Position=2326; Antisense; GAGTGACCATTCAGTGGACCTCTCC
>probe:Drosophila_2:1624138_at:224:627; Interrogation_Position=2355; Antisense; TGCCGGATCCCGATAAGGTTTACAA
>probe:Drosophila_2:1624138_at:77:659; Interrogation_Position=2383; Antisense; TAAGCCTAACGCTTCGGATCGAAAT
>probe:Drosophila_2:1624138_at:196:239; Interrogation_Position=2415; Antisense; AATCAGAGTCCAGCGATGCATCCGA
>probe:Drosophila_2:1624138_at:665:435; Interrogation_Position=2489; Antisense; GATGAACCCGCCTACAAAAAGTCCA
>probe:Drosophila_2:1624138_at:96:57; Interrogation_Position=2528; Antisense; ATGACTCTAATGGACACGGAGGCCA
>probe:Drosophila_2:1624138_at:563:21; Interrogation_Position=2552; Antisense; ATAGCGGCCAGTCTTTTGGGTAGCT

Paste this into a BLAST search page for me
ATGAAGGCCTTGAGTGCCAGGCAAAAACAGTGAACCAAGACGACGACGATTAATCTAGTGCTGTCCAAGGCGCTATCCAAGGCGCTACTCACCGAGGAGGTCAATATGACAAGCAGCGATTCCGGGAGCTGGTCAAGAAGCGCCACAAACGCCACAAACTGCAGCGCGAGAAGCTGAGTGACCATTCAGTGGACCTCTCCTGCCGGATCCCGATAAGGTTTACAATAAGCCTAACGCTTCGGATCGAAATAATCAGAGTCCAGCGATGCATCCGAGATGAACCCGCCTACAAAAAGTCCAATGACTCTAATGGACACGGAGGCCAATAGCGGCCAGTCTTTTGGGTAGCT

Full Affymetrix probeset data:

Annotations for 1624138_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720