Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624139_at:

>probe:Drosophila_2:1624139_at:576:5; Interrogation_Position=2192; Antisense; ATTGCGATTGCAACAGGACACACCA
>probe:Drosophila_2:1624139_at:722:461; Interrogation_Position=2231; Antisense; GATTCAATCCATCCATACATTCGGA
>probe:Drosophila_2:1624139_at:144:463; Interrogation_Position=2254; Antisense; GATTCGCCTCGTTCTGGACGGACAG
>probe:Drosophila_2:1624139_at:493:407; Interrogation_Position=2270; Antisense; GACGGACAGCCAACACGCAGGTGTA
>probe:Drosophila_2:1624139_at:132:485; Interrogation_Position=2316; Antisense; GTATGCATGCCTAGTAACATTACCT
>probe:Drosophila_2:1624139_at:677:275; Interrogation_Position=2348; Antisense; CTTCTTCGTCCTTGTGATTTTGTTT
>probe:Drosophila_2:1624139_at:340:701; Interrogation_Position=2390; Antisense; TTTTATTGCGTCTAATGCGCGCCAG
>probe:Drosophila_2:1624139_at:667:321; Interrogation_Position=2408; Antisense; GCGCCAGCCATCTAGTGTAATCAGT
>probe:Drosophila_2:1624139_at:723:359; Interrogation_Position=2442; Antisense; GAATGTAGCGTTCAACCACGGCCAT
>probe:Drosophila_2:1624139_at:592:259; Interrogation_Position=2473; Antisense; CACCCAGATGGTACATGGCTATCCA
>probe:Drosophila_2:1624139_at:166:583; Interrogation_Position=2488; Antisense; TGGCTATCCAGTGGTCCAACGTTAT
>probe:Drosophila_2:1624139_at:435:567; Interrogation_Position=2518; Antisense; GGCGCCAGAACGAGCCGAATCGGAT
>probe:Drosophila_2:1624139_at:55:527; Interrogation_Position=2571; Antisense; GGGAATGTACACACCTCATCTCACC
>probe:Drosophila_2:1624139_at:220:659; Interrogation_Position=2612; Antisense; TAAGCCCACACAAGCAAGCGTACAT

Paste this into a BLAST search page for me
ATTGCGATTGCAACAGGACACACCAGATTCAATCCATCCATACATTCGGAGATTCGCCTCGTTCTGGACGGACAGGACGGACAGCCAACACGCAGGTGTAGTATGCATGCCTAGTAACATTACCTCTTCTTCGTCCTTGTGATTTTGTTTTTTTATTGCGTCTAATGCGCGCCAGGCGCCAGCCATCTAGTGTAATCAGTGAATGTAGCGTTCAACCACGGCCATCACCCAGATGGTACATGGCTATCCATGGCTATCCAGTGGTCCAACGTTATGGCGCCAGAACGAGCCGAATCGGATGGGAATGTACACACCTCATCTCACCTAAGCCCACACAAGCAAGCGTACAT

Full Affymetrix probeset data:

Annotations for 1624139_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime