FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624141_at:

>probe:Drosophila_2:1624141_at:333:75; Interrogation_Position=1695; Antisense; AGGAGATCCTGAGCCTTGTTTCCGT
>probe:Drosophila_2:1624141_at:163:719; Interrogation_Position=1710; Antisense; TTGTTTCCGTTCTCTCAAGCGATCA
>probe:Drosophila_2:1624141_at:550:205; Interrogation_Position=1726; Antisense; AAGCGATCACGTCTTCGTCTCGAAT
>probe:Drosophila_2:1624141_at:1:137; Interrogation_Position=1761; Antisense; ACGAAATGGCTGCACTAGCTCACGC
>probe:Drosophila_2:1624141_at:115:651; Interrogation_Position=1780; Antisense; TCACGCCAAGTTTCAGTCCAAGCAT
>probe:Drosophila_2:1624141_at:240:65; Interrogation_Position=1803; Antisense; ATGGTGATCATTTGACGCTGCTGAA
>probe:Drosophila_2:1624141_at:233:327; Interrogation_Position=1894; Antisense; GCGTAGTTTAACCTATGCACGAAAT
>probe:Drosophila_2:1624141_at:530:345; Interrogation_Position=1954; Antisense; GCATTTGGCTCTAAATAGCTCGGAT
>probe:Drosophila_2:1624141_at:546:243; Interrogation_Position=2024; Antisense; AATATTGCCGTTCTGCAACGCGATG
>probe:Drosophila_2:1624141_at:397:199; Interrogation_Position=2040; Antisense; AACGCGATGGCTTCTACATAACCGC
>probe:Drosophila_2:1624141_at:87:647; Interrogation_Position=2076; Antisense; TCAGGTCCAAAATCCATCCGTCGAG
>probe:Drosophila_2:1624141_at:665:291; Interrogation_Position=2094; Antisense; CGTCGAGCGTTCTGCACGGAAAGTA
>probe:Drosophila_2:1624141_at:563:489; Interrogation_Position=2116; Antisense; GTACAAGCCGAGCTACATACTCTTC
>probe:Drosophila_2:1624141_at:37:407; Interrogation_Position=2155; Antisense; GACGGAGCAAACGTTTCTACGCCAA

Paste this into a BLAST search page for me
AGGAGATCCTGAGCCTTGTTTCCGTTTGTTTCCGTTCTCTCAAGCGATCAAAGCGATCACGTCTTCGTCTCGAATACGAAATGGCTGCACTAGCTCACGCTCACGCCAAGTTTCAGTCCAAGCATATGGTGATCATTTGACGCTGCTGAAGCGTAGTTTAACCTATGCACGAAATGCATTTGGCTCTAAATAGCTCGGATAATATTGCCGTTCTGCAACGCGATGAACGCGATGGCTTCTACATAACCGCTCAGGTCCAAAATCCATCCGTCGAGCGTCGAGCGTTCTGCACGGAAAGTAGTACAAGCCGAGCTACATACTCTTCGACGGAGCAAACGTTTCTACGCCAA

Full Affymetrix probeset data:

Annotations for 1624141_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720