Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624144_at:

>probe:Drosophila_2:1624144_at:178:3; Interrogation_Position=102; Antisense; ATTGTCGGACAAGCACTCGGAACGG
>probe:Drosophila_2:1624144_at:595:717; Interrogation_Position=220; Antisense; TTCGTGGGCTATACCTTCATTGCAG
>probe:Drosophila_2:1624144_at:375:621; Interrogation_Position=248; Antisense; TGCTGCTGCTCACGAGGATCATCGA
>probe:Drosophila_2:1624144_at:573:347; Interrogation_Position=275; Antisense; GCACCTCAAACTATGGCACCTGTGA
>probe:Drosophila_2:1624144_at:142:455; Interrogation_Position=300; Antisense; GATAATTCTGTTGACCTGTGGCGTT
>probe:Drosophila_2:1624144_at:687:579; Interrogation_Position=318; Antisense; TGGCGTTCTGTTCTTCACCATAGAG
>probe:Drosophila_2:1624144_at:553:527; Interrogation_Position=342; Antisense; GGGACTACTGATATTCTTCACGGTG
>probe:Drosophila_2:1624144_at:160:333; Interrogation_Position=372; Antisense; GCTGTCCGAAGATCTGCTGATATTT
>probe:Drosophila_2:1624144_at:646:3; Interrogation_Position=405; Antisense; ATTGGGAGCACTTTGCTTCATCTGC
>probe:Drosophila_2:1624144_at:180:321; Interrogation_Position=442; Antisense; GCCCTGGACCTGATGTTCTTCAAGA
>probe:Drosophila_2:1624144_at:700:579; Interrogation_Position=521; Antisense; TGGCCCTCAAGGTGTACAATCTTTC
>probe:Drosophila_2:1624144_at:274:617; Interrogation_Position=56; Antisense; TGCACGTCAAGATCATTGCCACGGT
>probe:Drosophila_2:1624144_at:576:73; Interrogation_Position=610; Antisense; AGGAACTATCTACGCACCGACTTGT
>probe:Drosophila_2:1624144_at:274:519; Interrogation_Position=79; Antisense; GTGGCGGCCCTGATTGTAAAGCGAT

Paste this into a BLAST search page for me
ATTGTCGGACAAGCACTCGGAACGGTTCGTGGGCTATACCTTCATTGCAGTGCTGCTGCTCACGAGGATCATCGAGCACCTCAAACTATGGCACCTGTGAGATAATTCTGTTGACCTGTGGCGTTTGGCGTTCTGTTCTTCACCATAGAGGGGACTACTGATATTCTTCACGGTGGCTGTCCGAAGATCTGCTGATATTTATTGGGAGCACTTTGCTTCATCTGCGCCCTGGACCTGATGTTCTTCAAGATGGCCCTCAAGGTGTACAATCTTTCTGCACGTCAAGATCATTGCCACGGTAGGAACTATCTACGCACCGACTTGTGTGGCGGCCCTGATTGTAAAGCGAT

Full Affymetrix probeset data:

Annotations for 1624144_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime