FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624146_at:

>probe:Drosophila_2:1624146_at:94:515; Interrogation_Position=441; Antisense; GTGTAAGTCTATGAACCGTTCGCAG
>probe:Drosophila_2:1624146_at:137:719; Interrogation_Position=459; Antisense; TTCGCAGTTCTGCTGGGCAATTAAC
>probe:Drosophila_2:1624146_at:281:563; Interrogation_Position=474; Antisense; GGCAATTAACCCGACTAGACAGTTT
>probe:Drosophila_2:1624146_at:404:39; Interrogation_Position=511; Antisense; ATGCTTTTTGTTTCAAACTCCTGTT
>probe:Drosophila_2:1624146_at:341:191; Interrogation_Position=526; Antisense; AACTCCTGTTGAAACGCTATAACGT
>probe:Drosophila_2:1624146_at:598:487; Interrogation_Position=608; Antisense; GTACGAGGCACCACTGTAAGTAATT
>probe:Drosophila_2:1624146_at:188:267; Interrogation_Position=638; Antisense; CAGGCTGATTTTTAATTGGGTACTT
>probe:Drosophila_2:1624146_at:554:571; Interrogation_Position=664; Antisense; TGGAGTTACCGGACTAACGCCGTGT
>probe:Drosophila_2:1624146_at:4:513; Interrogation_Position=685; Antisense; GTGTTTCACGCCACTTCCTTTAACA
>probe:Drosophila_2:1624146_at:551:697; Interrogation_Position=703; Antisense; TTTAACACAATAACCAACTCTCGCC
>probe:Drosophila_2:1624146_at:684:193; Interrogation_Position=718; Antisense; AACTCTCGCCTGTTTGTAACTAAAG
>probe:Drosophila_2:1624146_at:284:147; Interrogation_Position=736; Antisense; ACTAAAGCGCACCTATGTTTGCCCA
>probe:Drosophila_2:1624146_at:96:61; Interrogation_Position=750; Antisense; ATGTTTGCCCACTTTGTGTATGGAG
>probe:Drosophila_2:1624146_at:612:697; Interrogation_Position=807; Antisense; TTTATTTGTACTCTCCCCTAGATAC

Paste this into a BLAST search page for me
GTGTAAGTCTATGAACCGTTCGCAGTTCGCAGTTCTGCTGGGCAATTAACGGCAATTAACCCGACTAGACAGTTTATGCTTTTTGTTTCAAACTCCTGTTAACTCCTGTTGAAACGCTATAACGTGTACGAGGCACCACTGTAAGTAATTCAGGCTGATTTTTAATTGGGTACTTTGGAGTTACCGGACTAACGCCGTGTGTGTTTCACGCCACTTCCTTTAACATTTAACACAATAACCAACTCTCGCCAACTCTCGCCTGTTTGTAACTAAAGACTAAAGCGCACCTATGTTTGCCCAATGTTTGCCCACTTTGTGTATGGAGTTTATTTGTACTCTCCCCTAGATAC

Full Affymetrix probeset data:

Annotations for 1624146_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720