Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624149_at:

>probe:Drosophila_2:1624149_at:199:81; Interrogation_Position=1527; Antisense; AGTCGGATTTTATCTACCTAATGGA
>probe:Drosophila_2:1624149_at:431:229; Interrogation_Position=1546; Antisense; AATGGATCCGTATCGCCACAATATA
>probe:Drosophila_2:1624149_at:634:183; Interrogation_Position=1604; Antisense; AAAAGTGCCACGGTTCGCATGTTCG
>probe:Drosophila_2:1624149_at:559:601; Interrogation_Position=1623; Antisense; TGTTCGGTAATATGGATCGTCTGTT
>probe:Drosophila_2:1624149_at:488:451; Interrogation_Position=1637; Antisense; GATCGTCTGTTGAGTGTTTTCCATC
>probe:Drosophila_2:1624149_at:600:433; Interrogation_Position=1648; Antisense; GAGTGTTTTCCATCAGATCCTATTG
>probe:Drosophila_2:1624149_at:172:237; Interrogation_Position=1679; Antisense; AATCGATCCGCTGTATTCCATATAC
>probe:Drosophila_2:1624149_at:493:719; Interrogation_Position=1694; Antisense; TTCCATATACATACGCTCCGGATTA
>probe:Drosophila_2:1624149_at:460:21; Interrogation_Position=1722; Antisense; ATATTACAGAATGTCCGCCGGGCAC
>probe:Drosophila_2:1624149_at:638:605; Interrogation_Position=1816; Antisense; TGAGAACTACGACAAGTGCTTGCAA
>probe:Drosophila_2:1624149_at:539:17; Interrogation_Position=1860; Antisense; ATTTCGAGGAGGATCTCGTCTCCGA
>probe:Drosophila_2:1624149_at:463:201; Interrogation_Position=1890; Antisense; AACCCATTGTGGAGATCAGTTCCTC
>probe:Drosophila_2:1624149_at:645:281; Interrogation_Position=1998; Antisense; CTGCGGCTAATGGATATTTTCTTTA
>probe:Drosophila_2:1624149_at:427:485; Interrogation_Position=2037; Antisense; GTAGATTTTTAACGCCTCCATATAT

Paste this into a BLAST search page for me
AGTCGGATTTTATCTACCTAATGGAAATGGATCCGTATCGCCACAATATAAAAAGTGCCACGGTTCGCATGTTCGTGTTCGGTAATATGGATCGTCTGTTGATCGTCTGTTGAGTGTTTTCCATCGAGTGTTTTCCATCAGATCCTATTGAATCGATCCGCTGTATTCCATATACTTCCATATACATACGCTCCGGATTAATATTACAGAATGTCCGCCGGGCACTGAGAACTACGACAAGTGCTTGCAAATTTCGAGGAGGATCTCGTCTCCGAAACCCATTGTGGAGATCAGTTCCTCCTGCGGCTAATGGATATTTTCTTTAGTAGATTTTTAACGCCTCCATATAT

Full Affymetrix probeset data:

Annotations for 1624149_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime