FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624150_at:

>probe:Drosophila_2:1624150_at:553:13; Interrogation_Position=1004; Antisense; ATTAAGGTGGCCACGCACAGCAACA
>probe:Drosophila_2:1624150_at:516:111; Interrogation_Position=1022; Antisense; AGCAACATTGCTCTGTGCCACCAAA
>probe:Drosophila_2:1624150_at:133:597; Interrogation_Position=1035; Antisense; TGTGCCACCAAAAGTCCAACGATCA
>probe:Drosophila_2:1624150_at:191:139; Interrogation_Position=1053; Antisense; ACGATCACTTCGAAGCCAAGCAGGA
>probe:Drosophila_2:1624150_at:182:229; Interrogation_Position=1109; Antisense; AATGTAAAGGCTCTCTACCGTCGTG
>probe:Drosophila_2:1624150_at:662:673; Interrogation_Position=1124; Antisense; TACCGTCGTGGCCAATGCAACTTGA
>probe:Drosophila_2:1624150_at:310:79; Interrogation_Position=1188; Antisense; AGGTCATCCAATTGGAGCCTGGCAA
>probe:Drosophila_2:1624150_at:318:205; Interrogation_Position=1215; Antisense; AAGCGGCTGCCAACCAAGTGATCAT
>probe:Drosophila_2:1624150_at:51:391; Interrogation_Position=1279; Antisense; GAAACTCTATGCCAACATGTTCACC
>probe:Drosophila_2:1624150_at:495:153; Interrogation_Position=1293; Antisense; ACATGTTCACCAAACTGGCTGCCAA
>probe:Drosophila_2:1624150_at:380:629; Interrogation_Position=1336; Antisense; TCCGCGGGAAACTGACGTGCTGAGC
>probe:Drosophila_2:1624150_at:84:299; Interrogation_Position=1410; Antisense; CGCTGGAGCGCGACAATATAATCAT
>probe:Drosophila_2:1624150_at:656:245; Interrogation_Position=1440; Antisense; AATTCAGATCGACTAGTGCTTTAAG
>probe:Drosophila_2:1624150_at:417:677; Interrogation_Position=1475; Antisense; TAGGGTTTATAATCCCACATCGAAA

Paste this into a BLAST search page for me
ATTAAGGTGGCCACGCACAGCAACAAGCAACATTGCTCTGTGCCACCAAATGTGCCACCAAAAGTCCAACGATCAACGATCACTTCGAAGCCAAGCAGGAAATGTAAAGGCTCTCTACCGTCGTGTACCGTCGTGGCCAATGCAACTTGAAGGTCATCCAATTGGAGCCTGGCAAAAGCGGCTGCCAACCAAGTGATCATGAAACTCTATGCCAACATGTTCACCACATGTTCACCAAACTGGCTGCCAATCCGCGGGAAACTGACGTGCTGAGCCGCTGGAGCGCGACAATATAATCATAATTCAGATCGACTAGTGCTTTAAGTAGGGTTTATAATCCCACATCGAAA

Full Affymetrix probeset data:

Annotations for 1624150_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720