Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624152_at:

>probe:Drosophila_2:1624152_at:434:357; Interrogation_Position=1797; Antisense; GCAAGTATACGGCTCTGGAACCCAA
>probe:Drosophila_2:1624152_at:492:535; Interrogation_Position=1845; Antisense; GGTCGGTGATGAAGAGTCTGCCCTT
>probe:Drosophila_2:1624152_at:572:629; Interrogation_Position=1869; Antisense; TCCTCATTCCGGAGAAGTCGCACAA
>probe:Drosophila_2:1624152_at:292:169; Interrogation_Position=1892; Antisense; AAAGTGTTACGTGCCTTCTATGTGC
>probe:Drosophila_2:1624152_at:564:679; Interrogation_Position=1910; Antisense; TATGTGCCATTCCTGACCGACAATC
>probe:Drosophila_2:1624152_at:467:395; Interrogation_Position=1928; Antisense; GACAATCACATTCAGTACGGAGACT
>probe:Drosophila_2:1624152_at:726:423; Interrogation_Position=1947; Antisense; GAGACTTTAATCTGCTCAAGCGAAA
>probe:Drosophila_2:1624152_at:411:393; Interrogation_Position=2009; Antisense; GAAAGAGTCTGGATTCATGCCACAA
>probe:Drosophila_2:1624152_at:300:533; Interrogation_Position=2052; Antisense; GGTGGCTCTCTTATTCTTTCAAAAC
>probe:Drosophila_2:1624152_at:640:513; Interrogation_Position=2157; Antisense; GTGATTTCCAAGTATCTTACACCCC
>probe:Drosophila_2:1624152_at:629:415; Interrogation_Position=2185; Antisense; GAGCCTCTGTCTGTATTCCAAATAA
>probe:Drosophila_2:1624152_at:154:241; Interrogation_Position=2205; Antisense; AATAATCTTTCGTACCCAGCATTGA
>probe:Drosophila_2:1624152_at:546:39; Interrogation_Position=2247; Antisense; ATCTGTTCTAAGTCAGTGAAGCGTT
>probe:Drosophila_2:1624152_at:587:291; Interrogation_Position=2281; Antisense; CGTTATTTTCGTTTTGTCCATGCCA

Paste this into a BLAST search page for me
GCAAGTATACGGCTCTGGAACCCAAGGTCGGTGATGAAGAGTCTGCCCTTTCCTCATTCCGGAGAAGTCGCACAAAAAGTGTTACGTGCCTTCTATGTGCTATGTGCCATTCCTGACCGACAATCGACAATCACATTCAGTACGGAGACTGAGACTTTAATCTGCTCAAGCGAAAGAAAGAGTCTGGATTCATGCCACAAGGTGGCTCTCTTATTCTTTCAAAACGTGATTTCCAAGTATCTTACACCCCGAGCCTCTGTCTGTATTCCAAATAAAATAATCTTTCGTACCCAGCATTGAATCTGTTCTAAGTCAGTGAAGCGTTCGTTATTTTCGTTTTGTCCATGCCA

Full Affymetrix probeset data:

Annotations for 1624152_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime