FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624153_at:

>probe:Drosophila_2:1624153_at:631:719; Interrogation_Position=341; Antisense; TTCCTGCTGAACAAGCCCGGAGTGG
>probe:Drosophila_2:1624153_at:567:309; Interrogation_Position=355; Antisense; GCCCGGAGTGGGATATTACGTAACA
>probe:Drosophila_2:1624153_at:617:367; Interrogation_Position=405; Antisense; GAATGCTGAATTCCCTGGACAACCT
>probe:Drosophila_2:1624153_at:492:551; Interrogation_Position=442; Antisense; GGAGATCTACACTCGCGAGATGCAC
>probe:Drosophila_2:1624153_at:399:223; Interrogation_Position=489; Antisense; AAGGAACCGTTCCATGCTGGGTGTA
>probe:Drosophila_2:1624153_at:403:269; Interrogation_Position=501; Antisense; CATGCTGGGTGTACCTGCTGCAGAA
>probe:Drosophila_2:1624153_at:279:551; Interrogation_Position=532; Antisense; GGAGAACCTACTTAGTCTGCGCTAC
>probe:Drosophila_2:1624153_at:351:279; Interrogation_Position=553; Antisense; CTACTTGTCCAGCTACGAGAACTCA
>probe:Drosophila_2:1624153_at:272:653; Interrogation_Position=659; Antisense; TAATAACGTGGGTTGTGGTGTCGCC
>probe:Drosophila_2:1624153_at:712:515; Interrogation_Position=676; Antisense; GTGTCGCCCGTTTGTTTGGATGTTC
>probe:Drosophila_2:1624153_at:51:691; Interrogation_Position=690; Antisense; TTTGGATGTTCTCTGGATAGCCTGG
>probe:Drosophila_2:1624153_at:580:125; Interrogation_Position=708; Antisense; AGCCTGGCCACTAATCTTATGTTAC
>probe:Drosophila_2:1624153_at:368:659; Interrogation_Position=730; Antisense; TACCGTAGTTGCATTTTAAGACCGT
>probe:Drosophila_2:1624153_at:89:213; Interrogation_Position=747; Antisense; AAGACCGTACTTGCAGACGCAGATG

Paste this into a BLAST search page for me
TTCCTGCTGAACAAGCCCGGAGTGGGCCCGGAGTGGGATATTACGTAACAGAATGCTGAATTCCCTGGACAACCTGGAGATCTACACTCGCGAGATGCACAAGGAACCGTTCCATGCTGGGTGTACATGCTGGGTGTACCTGCTGCAGAAGGAGAACCTACTTAGTCTGCGCTACCTACTTGTCCAGCTACGAGAACTCATAATAACGTGGGTTGTGGTGTCGCCGTGTCGCCCGTTTGTTTGGATGTTCTTTGGATGTTCTCTGGATAGCCTGGAGCCTGGCCACTAATCTTATGTTACTACCGTAGTTGCATTTTAAGACCGTAAGACCGTACTTGCAGACGCAGATG

Full Affymetrix probeset data:

Annotations for 1624153_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720