FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624154_at:

>probe:Drosophila_2:1624154_at:572:285; Interrogation_Position=1108; Antisense; CTGGTTTCGAGTTTGCATTGTGTAA
>probe:Drosophila_2:1624154_at:364:673; Interrogation_Position=595; Antisense; TACCAAGTGGCGAATGCCCTCAACT
>probe:Drosophila_2:1624154_at:373:305; Interrogation_Position=627; Antisense; CCTGAACAACGTGATCCATCGGGAT
>probe:Drosophila_2:1624154_at:672:385; Interrogation_Position=663; Antisense; GAACATTCTGCTAACCAGCACGGAC
>probe:Drosophila_2:1624154_at:259:545; Interrogation_Position=684; Antisense; GGACGACCTTAAGCTGGCCGACTTT
>probe:Drosophila_2:1624154_at:593:403; Interrogation_Position=703; Antisense; GACTTTGGTTGGTCGGCGCACACGC
>probe:Drosophila_2:1624154_at:138:187; Interrogation_Position=733; Antisense; AACAAGCGCAGGACTCTGTGCGGCA
>probe:Drosophila_2:1624154_at:404:671; Interrogation_Position=799; Antisense; TACGACGACTCGGTGGACCAGTGGT
>probe:Drosophila_2:1624154_at:93:571; Interrogation_Position=829; Antisense; GGCATTCTGTGCTACGAGTTCGTCG
>probe:Drosophila_2:1624154_at:586:431; Interrogation_Position=871; Antisense; GAGTCGAACAGCACGGAGAGCACCT
>probe:Drosophila_2:1624154_at:261:425; Interrogation_Position=886; Antisense; GAGAGCACCTACAGCAAGATCCGGC
>probe:Drosophila_2:1624154_at:412:215; Interrogation_Position=901; Antisense; AAGATCCGGCGCATGGAGATCTCCT
>probe:Drosophila_2:1624154_at:723:225; Interrogation_Position=952; Antisense; AAGGAATTGATTGGCGGGCTGCTTC
>probe:Drosophila_2:1624154_at:658:221; Interrogation_Position=988; Antisense; AAGGGCCGCATCACCTTGGTGGATG

Paste this into a BLAST search page for me
CTGGTTTCGAGTTTGCATTGTGTAATACCAAGTGGCGAATGCCCTCAACTCCTGAACAACGTGATCCATCGGGATGAACATTCTGCTAACCAGCACGGACGGACGACCTTAAGCTGGCCGACTTTGACTTTGGTTGGTCGGCGCACACGCAACAAGCGCAGGACTCTGTGCGGCATACGACGACTCGGTGGACCAGTGGTGGCATTCTGTGCTACGAGTTCGTCGGAGTCGAACAGCACGGAGAGCACCTGAGAGCACCTACAGCAAGATCCGGCAAGATCCGGCGCATGGAGATCTCCTAAGGAATTGATTGGCGGGCTGCTTCAAGGGCCGCATCACCTTGGTGGATG

Full Affymetrix probeset data:

Annotations for 1624154_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720