Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624156_at:

>probe:Drosophila_2:1624156_at:283:81; Interrogation_Position=1444; Antisense; AGGGTGCGCGACATGTCCGACAGAT
>probe:Drosophila_2:1624156_at:36:505; Interrogation_Position=1458; Antisense; GTCCGACAGATATCGCGATCAGCAG
>probe:Drosophila_2:1624156_at:322:293; Interrogation_Position=1473; Antisense; CGATCAGCAGCAGACTCCTTTGGAG
>probe:Drosophila_2:1624156_at:633:367; Interrogation_Position=1485; Antisense; GACTCCTTTGGAGCGGGCCGTTTAT
>probe:Drosophila_2:1624156_at:392:63; Interrogation_Position=1520; Antisense; ATGTGTCCCGGCATAAGGGTGCCAA
>probe:Drosophila_2:1624156_at:126:627; Interrogation_Position=1539; Antisense; TGCCAAGTATCTAAGGAGCGCCTCC
>probe:Drosophila_2:1624156_at:197:315; Interrogation_Position=1558; Antisense; GCCTCCCAGGATCTGAATTTCATTC
>probe:Drosophila_2:1624156_at:413:127; Interrogation_Position=1586; Antisense; ACCACAATCTGGACGCAATGCTGAT
>probe:Drosophila_2:1624156_at:448:569; Interrogation_Position=1621; Antisense; GGCATTATATTCGTGCTCTATTGTA
>probe:Drosophila_2:1624156_at:529:337; Interrogation_Position=1635; Antisense; GCTCTATTGTATTTTCCTGCTGATC
>probe:Drosophila_2:1624156_at:123:307; Interrogation_Position=1650; Antisense; CCTGCTGATCCGTTTAGTGTGGCGA
>probe:Drosophila_2:1624156_at:228:679; Interrogation_Position=1664; Antisense; TAGTGTGGCGACTCCTGCAGGAATT
>probe:Drosophila_2:1624156_at:687:537; Interrogation_Position=1762; Antisense; GGTTTCCATGACCAGTTTAAATTAG
>probe:Drosophila_2:1624156_at:439:479; Interrogation_Position=1871; Antisense; GTTTCATGAAAACTCCTTCCCATTT

Paste this into a BLAST search page for me
AGGGTGCGCGACATGTCCGACAGATGTCCGACAGATATCGCGATCAGCAGCGATCAGCAGCAGACTCCTTTGGAGGACTCCTTTGGAGCGGGCCGTTTATATGTGTCCCGGCATAAGGGTGCCAATGCCAAGTATCTAAGGAGCGCCTCCGCCTCCCAGGATCTGAATTTCATTCACCACAATCTGGACGCAATGCTGATGGCATTATATTCGTGCTCTATTGTAGCTCTATTGTATTTTCCTGCTGATCCCTGCTGATCCGTTTAGTGTGGCGATAGTGTGGCGACTCCTGCAGGAATTGGTTTCCATGACCAGTTTAAATTAGGTTTCATGAAAACTCCTTCCCATTT

Full Affymetrix probeset data:

Annotations for 1624156_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime