Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624157_at:

>probe:Drosophila_2:1624157_at:610:301; Interrogation_Position=1509; Antisense; CCCTTTGGCTGGCAGTGATTTCTTA
>probe:Drosophila_2:1624157_at:310:95; Interrogation_Position=1535; Antisense; AGATATCGCAATTCTTTCACACCGT
>probe:Drosophila_2:1624157_at:215:447; Interrogation_Position=1605; Antisense; GATGCGACGATTTATCACGCTCATA
>probe:Drosophila_2:1624157_at:399:259; Interrogation_Position=1620; Antisense; CACGCTCATAGATACCCTTTACAAT
>probe:Drosophila_2:1624157_at:193:23; Interrogation_Position=1663; Antisense; ATATCATCCGACGTTGCGCTGGAAA
>probe:Drosophila_2:1624157_at:669:471; Interrogation_Position=1692; Antisense; GTTCAGCTTTACTGGAGGTTCCAAA
>probe:Drosophila_2:1624157_at:680:59; Interrogation_Position=1707; Antisense; AGGTTCCAAAACTCTGTCCGATTCT
>probe:Drosophila_2:1624157_at:318:501; Interrogation_Position=1722; Antisense; GTCCGATTCTGAGCGAACCCTAATG
>probe:Drosophila_2:1624157_at:518:255; Interrogation_Position=1770; Antisense; CAAAGCCAGTTTTTTCACCGGCGAG
>probe:Drosophila_2:1624157_at:46:439; Interrogation_Position=1792; Antisense; GAGGAAGAGCTGTTCGCCTTTGATC
>probe:Drosophila_2:1624157_at:443:357; Interrogation_Position=1817; Antisense; GCACACTATCTCGACTCTATGAAAT
>probe:Drosophila_2:1624157_at:415:151; Interrogation_Position=1875; Antisense; ACATCGATGAAAACCCCTTGTCACA
>probe:Drosophila_2:1624157_at:642:245; Interrogation_Position=1927; Antisense; AATTACATGTTTTCTACCTCGCTGA
>probe:Drosophila_2:1624157_at:542:281; Interrogation_Position=1944; Antisense; CTCGCTGACGCGGTATTTTAAAATT

Paste this into a BLAST search page for me
CCCTTTGGCTGGCAGTGATTTCTTAAGATATCGCAATTCTTTCACACCGTGATGCGACGATTTATCACGCTCATACACGCTCATAGATACCCTTTACAATATATCATCCGACGTTGCGCTGGAAAGTTCAGCTTTACTGGAGGTTCCAAAAGGTTCCAAAACTCTGTCCGATTCTGTCCGATTCTGAGCGAACCCTAATGCAAAGCCAGTTTTTTCACCGGCGAGGAGGAAGAGCTGTTCGCCTTTGATCGCACACTATCTCGACTCTATGAAATACATCGATGAAAACCCCTTGTCACAAATTACATGTTTTCTACCTCGCTGACTCGCTGACGCGGTATTTTAAAATT

Full Affymetrix probeset data:

Annotations for 1624157_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime