FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624159_at:

>probe:Drosophila_2:1624159_at:476:55; Interrogation_Position=1010; Antisense; ATGAACTCTGCTTGAATCCCACGGT
>probe:Drosophila_2:1624159_at:68:237; Interrogation_Position=1024; Antisense; AATCCCACGGTGCAGGACAGGTTGT
>probe:Drosophila_2:1624159_at:726:435; Interrogation_Position=1051; Antisense; GAGGAGATCATTTCCGTGCACGAAG
>probe:Drosophila_2:1624159_at:104:41; Interrogation_Position=1124; Antisense; ATCTGGACATGGTGGTACTCGAAGC
>probe:Drosophila_2:1624159_at:460:377; Interrogation_Position=1144; Antisense; GAAGCACTGCGTAAATGGCCACCAT
>probe:Drosophila_2:1624159_at:131:131; Interrogation_Position=1177; Antisense; ACCGATCGTGAGTGCCGTCAGGATA
>probe:Drosophila_2:1624159_at:101:229; Interrogation_Position=1219; Antisense; AATGGTCAGAAGTTGTTCTCCGCCC
>probe:Drosophila_2:1624159_at:573:495; Interrogation_Position=1255; Antisense; GTCTTGCAAATACCTATCTTCTCGC
>probe:Drosophila_2:1624159_at:219:429; Interrogation_Position=1312; Antisense; GAGTTCTTCAATCCGGAGCGCTTCG
>probe:Drosophila_2:1624159_at:16:351; Interrogation_Position=1336; Antisense; GCAGATGGTCATGCTCTAGAGTCCC
>probe:Drosophila_2:1624159_at:264:673; Interrogation_Position=1352; Antisense; TAGAGTCCCGTGTTTACATGCCCTT
>probe:Drosophila_2:1624159_at:85:185; Interrogation_Position=1477; Antisense; AAAAGGACTTCTCGCGATTTGCTGA
>probe:Drosophila_2:1624159_at:77:717; Interrogation_Position=1540; Antisense; TTCTGGCTGAAGTTCGAGGCACGTC
>probe:Drosophila_2:1624159_at:519:607; Interrogation_Position=975; Antisense; TGAGATTATCTCGTCGTCCTTGTGC

Paste this into a BLAST search page for me
ATGAACTCTGCTTGAATCCCACGGTAATCCCACGGTGCAGGACAGGTTGTGAGGAGATCATTTCCGTGCACGAAGATCTGGACATGGTGGTACTCGAAGCGAAGCACTGCGTAAATGGCCACCATACCGATCGTGAGTGCCGTCAGGATAAATGGTCAGAAGTTGTTCTCCGCCCGTCTTGCAAATACCTATCTTCTCGCGAGTTCTTCAATCCGGAGCGCTTCGGCAGATGGTCATGCTCTAGAGTCCCTAGAGTCCCGTGTTTACATGCCCTTAAAAGGACTTCTCGCGATTTGCTGATTCTGGCTGAAGTTCGAGGCACGTCTGAGATTATCTCGTCGTCCTTGTGC

Full Affymetrix probeset data:

Annotations for 1624159_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720