FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624160_at:

>probe:Drosophila_2:1624160_at:620:575; Interrogation_Position=297; Antisense; TGGTTTACGCCAAGACGGACGCTAC
>probe:Drosophila_2:1624160_at:81:437; Interrogation_Position=356; Antisense; GAGGAGTGTCAGTACTTTTCGAAAC
>probe:Drosophila_2:1624160_at:91:153; Interrogation_Position=414; Antisense; ACATCGCCTGGAATGACGCCTACAA
>probe:Drosophila_2:1624160_at:222:161; Interrogation_Position=435; Antisense; ACAATGATATCGTCCTACAGGCCAG
>probe:Drosophila_2:1624160_at:568:667; Interrogation_Position=450; Antisense; TACAGGCCAGCTCGAAGCCGTTGAA
>probe:Drosophila_2:1624160_at:292:571; Interrogation_Position=518; Antisense; GGCTACTTCATGGAGGTGACCGACA
>probe:Drosophila_2:1624160_at:262:395; Interrogation_Position=539; Antisense; GACAGAATCTACCTAGGTCCACGTA
>probe:Drosophila_2:1624160_at:513:315; Interrogation_Position=564; Antisense; GCCTCGTCGAGCTCAGTTTCTATTT
>probe:Drosophila_2:1624160_at:354:477; Interrogation_Position=579; Antisense; GTTTCTATTTGAGCTCGAACCACGC
>probe:Drosophila_2:1624160_at:438:219; Interrogation_Position=632; Antisense; AAGTGCCTGGTGTTGTGGGACATTC
>probe:Drosophila_2:1624160_at:131:531; Interrogation_Position=689; Antisense; GGGTGCATCCAAACCTACTTGCAGA
>probe:Drosophila_2:1624160_at:543:723; Interrogation_Position=707; Antisense; TTGCAGAGACGCGATATTTGCCCCT
>probe:Drosophila_2:1624160_at:66:397; Interrogation_Position=748; Antisense; GACAACTCCAATAAGACGCTCCATT
>probe:Drosophila_2:1624160_at:705:597; Interrogation_Position=785; Antisense; TGTCCGCGACATGTACTATAGATTT

Paste this into a BLAST search page for me
TGGTTTACGCCAAGACGGACGCTACGAGGAGTGTCAGTACTTTTCGAAACACATCGCCTGGAATGACGCCTACAAACAATGATATCGTCCTACAGGCCAGTACAGGCCAGCTCGAAGCCGTTGAAGGCTACTTCATGGAGGTGACCGACAGACAGAATCTACCTAGGTCCACGTAGCCTCGTCGAGCTCAGTTTCTATTTGTTTCTATTTGAGCTCGAACCACGCAAGTGCCTGGTGTTGTGGGACATTCGGGTGCATCCAAACCTACTTGCAGATTGCAGAGACGCGATATTTGCCCCTGACAACTCCAATAAGACGCTCCATTTGTCCGCGACATGTACTATAGATTT

Full Affymetrix probeset data:

Annotations for 1624160_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720