Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624163_at:

>probe:Drosophila_2:1624163_at:251:359; Interrogation_Position=132; Antisense; GCAACAAAATCCATTAGAAGACCAA
>probe:Drosophila_2:1624163_at:53:591; Interrogation_Position=14; Antisense; TGGTGGGTCATATCAGAAAGTGCCG
>probe:Drosophila_2:1624163_at:364:15; Interrogation_Position=144; Antisense; ATTAGAAGACCAACAACATCCGCAG
>probe:Drosophila_2:1624163_at:440:497; Interrogation_Position=20; Antisense; GTCATATCAGAAAGTGCCGCGCCAT
>probe:Drosophila_2:1624163_at:411:359; Interrogation_Position=203; Antisense; GCAACTACAAGCTTCATTTCGACAA
>probe:Drosophila_2:1624163_at:488:341; Interrogation_Position=213; Antisense; GCTTCATTTCGACAAAATTGCTGGG
>probe:Drosophila_2:1624163_at:421:23; Interrogation_Position=23; Antisense; ATATCAGAAAGTGCCGCGCCATGAT
>probe:Drosophila_2:1624163_at:366:171; Interrogation_Position=30; Antisense; AAAGTGCCGCGCCATGATTGTTCTG
>probe:Drosophila_2:1624163_at:224:87; Interrogation_Position=32; Antisense; AGTGCCGCGCCATGATTGTTCTGGG
>probe:Drosophila_2:1624163_at:77:271; Interrogation_Position=42; Antisense; CATGATTGTTCTGGGCGGCGTGACC
>probe:Drosophila_2:1624163_at:296:531; Interrogation_Position=68; Antisense; GGGTCACTTGCTGCAGCAACAACGA
>probe:Drosophila_2:1624163_at:405:495; Interrogation_Position=70; Antisense; GTCACTTGCTGCAGCAACAACGACA
>probe:Drosophila_2:1624163_at:13:199; Interrogation_Position=88; Antisense; AACGACAACTGCAAAAATCCGCAAC
>probe:Drosophila_2:1624163_at:219:359; Interrogation_Position=98; Antisense; GCAAAAATCCGCAACAACTCCAGCA

Paste this into a BLAST search page for me
GCAACAAAATCCATTAGAAGACCAATGGTGGGTCATATCAGAAAGTGCCGATTAGAAGACCAACAACATCCGCAGGTCATATCAGAAAGTGCCGCGCCATGCAACTACAAGCTTCATTTCGACAAGCTTCATTTCGACAAAATTGCTGGGATATCAGAAAGTGCCGCGCCATGATAAAGTGCCGCGCCATGATTGTTCTGAGTGCCGCGCCATGATTGTTCTGGGCATGATTGTTCTGGGCGGCGTGACCGGGTCACTTGCTGCAGCAACAACGAGTCACTTGCTGCAGCAACAACGACAAACGACAACTGCAAAAATCCGCAACGCAAAAATCCGCAACAACTCCAGCA

Full Affymetrix probeset data:

Annotations for 1624163_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime