Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624168_at:

>probe:Drosophila_2:1624168_at:409:713; Interrogation_Position=2864; Antisense; TTCGGGAATCCCATCGCCGGAGATG
>probe:Drosophila_2:1624168_at:429:427; Interrogation_Position=2883; Antisense; GAGATGCACCGCTCCAGCTGTACGA
>probe:Drosophila_2:1624168_at:714:599; Interrogation_Position=2901; Antisense; TGTACGACATTCTGAGCAGCAGCAG
>probe:Drosophila_2:1624168_at:276:123; Interrogation_Position=2924; Antisense; AGCGAGCTGCTGATGGAGACCTCAT
>probe:Drosophila_2:1624168_at:679:411; Interrogation_Position=2941; Antisense; GACCTCATCCTTTCTGGACAAGTCG
>probe:Drosophila_2:1624168_at:238:397; Interrogation_Position=2957; Antisense; GACAAGTCGTCCATTGTCTGATCCG
>probe:Drosophila_2:1624168_at:195:499; Interrogation_Position=2972; Antisense; GTCTGATCCGCACACAAATCGGAGA
>probe:Drosophila_2:1624168_at:243:157; Interrogation_Position=3010; Antisense; ACACTCGTTCCACTTGTTTATTCAA
>probe:Drosophila_2:1624168_at:672:647; Interrogation_Position=3031; Antisense; TCAAAACGCTGAACTTTCGAAGTAT
>probe:Drosophila_2:1624168_at:187:159; Interrogation_Position=3115; Antisense; ACACAGAGGTGCAATTTCCTCACAT
>probe:Drosophila_2:1624168_at:354:719; Interrogation_Position=3130; Antisense; TTCCTCACATATACATGGCATATCG
>probe:Drosophila_2:1624168_at:76:571; Interrogation_Position=3146; Antisense; GGCATATCGCTTTTAACACTTTTGA
>probe:Drosophila_2:1624168_at:415:701; Interrogation_Position=3220; Antisense; TTTTACTACCACCAAACTGCATTGC
>probe:Drosophila_2:1624168_at:182:195; Interrogation_Position=3234; Antisense; AACTGCATTGCATCGCTGCATTATA

Paste this into a BLAST search page for me
TTCGGGAATCCCATCGCCGGAGATGGAGATGCACCGCTCCAGCTGTACGATGTACGACATTCTGAGCAGCAGCAGAGCGAGCTGCTGATGGAGACCTCATGACCTCATCCTTTCTGGACAAGTCGGACAAGTCGTCCATTGTCTGATCCGGTCTGATCCGCACACAAATCGGAGAACACTCGTTCCACTTGTTTATTCAATCAAAACGCTGAACTTTCGAAGTATACACAGAGGTGCAATTTCCTCACATTTCCTCACATATACATGGCATATCGGGCATATCGCTTTTAACACTTTTGATTTTACTACCACCAAACTGCATTGCAACTGCATTGCATCGCTGCATTATA

Full Affymetrix probeset data:

Annotations for 1624168_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime