Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624170_at:

>probe:Drosophila_2:1624170_at:452:705; Interrogation_Position=101; Antisense; TTAGCCACCATCTGGAGCAGCGGGA
>probe:Drosophila_2:1624170_at:238:379; Interrogation_Position=17; Antisense; GAAGCGCAAGCGTACCGAATATCAT
>probe:Drosophila_2:1624170_at:186:353; Interrogation_Position=177; Antisense; GCAGCAGGATCAACCGCCGATGGAA
>probe:Drosophila_2:1624170_at:15:661; Interrogation_Position=222; Antisense; TAACAGCAAGGATGGTGCCGCCAAT
>probe:Drosophila_2:1624170_at:437:297; Interrogation_Position=32; Antisense; CGAATATCATCATCTGGAGCGGCAT
>probe:Drosophila_2:1624170_at:185:211; Interrogation_Position=331; Antisense; AAGAAGCTTGGCATCACCGGCGGAT
>probe:Drosophila_2:1624170_at:250:463; Interrogation_Position=353; Antisense; GATTCCCTTGTCGTTGTGGTGGCAC
>probe:Drosophila_2:1624170_at:692:131; Interrogation_Position=392; Antisense; ACCGCTACAGTGATCGCCATGAATG
>probe:Drosophila_2:1624170_at:382:243; Interrogation_Position=418; Antisense; AATTTCGACTATCGCCAAATGGGCG
>probe:Drosophila_2:1624170_at:372:159; Interrogation_Position=449; Antisense; AAATCCGGCGTGATAATCCCGTCGT
>probe:Drosophila_2:1624170_at:461:467; Interrogation_Position=472; Antisense; GTTGTCGCCAGCAAACTCCGAAAGC
>probe:Drosophila_2:1624170_at:252:65; Interrogation_Position=55; Antisense; ATGGATGCAGGCACCCAGTCGGCGA
>probe:Drosophila_2:1624170_at:339:89; Interrogation_Position=71; Antisense; AGTCGGCGATGTCAATTCAGCTGCA
>probe:Drosophila_2:1624170_at:482:711; Interrogation_Position=86; Antisense; TTCAGCTGCATGGATTTAGCCACCA

Paste this into a BLAST search page for me
TTAGCCACCATCTGGAGCAGCGGGAGAAGCGCAAGCGTACCGAATATCATGCAGCAGGATCAACCGCCGATGGAATAACAGCAAGGATGGTGCCGCCAATCGAATATCATCATCTGGAGCGGCATAAGAAGCTTGGCATCACCGGCGGATGATTCCCTTGTCGTTGTGGTGGCACACCGCTACAGTGATCGCCATGAATGAATTTCGACTATCGCCAAATGGGCGAAATCCGGCGTGATAATCCCGTCGTGTTGTCGCCAGCAAACTCCGAAAGCATGGATGCAGGCACCCAGTCGGCGAAGTCGGCGATGTCAATTCAGCTGCATTCAGCTGCATGGATTTAGCCACCA

Full Affymetrix probeset data:

Annotations for 1624170_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime